ID: 1089619128

View in Genome Browser
Species Human (GRCh38)
Location 11:119712503-119712525
Sequence TGCAAGGCTTAGGACGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089619118_1089619128 29 Left 1089619118 11:119712451-119712473 CCTGTTTTGAGGCCAGTTCATCC 0: 1
1: 0
2: 1
3: 20
4: 593
Right 1089619128 11:119712503-119712525 TGCAAGGCTTAGGACGGGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 156
1089619120_1089619128 8 Left 1089619120 11:119712472-119712494 CCATCACTACTGTACTCTCAGCC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1089619128 11:119712503-119712525 TGCAAGGCTTAGGACGGGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 156
1089619119_1089619128 17 Left 1089619119 11:119712463-119712485 CCAGTTCATCCATCACTACTGTA 0: 1
1: 0
2: 3
3: 12
4: 110
Right 1089619128 11:119712503-119712525 TGCAAGGCTTAGGACGGGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089619128 Original CRISPR TGCAAGGCTTAGGACGGGAG AGG Intronic
901260398 1:7866520-7866542 TGCAGGGCCTAGGATGGGTGTGG - Intergenic
902919961 1:19659850-19659872 TGCAAGGCTGCAGGCGGGAGAGG + Intergenic
904719265 1:32494527-32494549 TGCAATGCTTAGACAGGGAGGGG + Exonic
906002460 1:42438582-42438604 TGGAAGGCATAGTAGGGGAGTGG - Intronic
906707395 1:47904676-47904698 TGCAAAGCCTAGTACAGGAGAGG + Intronic
908992761 1:70113072-70113094 TTCAAGGCTCAGAATGGGAGAGG + Intronic
910042806 1:82873942-82873964 TGAAAGGCTTAGCAGGAGAGAGG + Intergenic
912711345 1:111952292-111952314 TGCAAGGGTTGGGTAGGGAGTGG - Intronic
913050931 1:115116032-115116054 TGGAGAGCTAAGGACGGGAGGGG - Intergenic
913268779 1:117072097-117072119 TGCATGGCTTAGTTCGGCAGTGG + Intronic
916896825 1:169172111-169172133 TGCAAGGCTGAGGAAGGGCATGG - Intronic
919614669 1:199791139-199791161 TGGAAAGCTTAAGAAGGGAGGGG - Intergenic
922975289 1:229778992-229779014 TGCAGGGCTTGGGGCTGGAGCGG - Intergenic
1063082688 10:2783390-2783412 TGGAAGGATGAGGAGGGGAGAGG + Intergenic
1065472035 10:26092175-26092197 TGCAAAGCTTCGGCCGGGTGCGG + Intronic
1065535670 10:26712726-26712748 AGAAAGGCTTAGGACAGTAGGGG + Intronic
1065855472 10:29826799-29826821 TCAAAGGCTTGGGGCGGGAGAGG - Intergenic
1067067383 10:43111553-43111575 TGCAAGGCTTAGCTGGGGAGTGG + Intronic
1069761273 10:70813185-70813207 CGGAAGGCTTGGGACGGGGGAGG - Intergenic
1070703385 10:78619385-78619407 TTCAAGGCTTGGGTGGGGAGGGG + Intergenic
1072399889 10:95087050-95087072 TGCAAAGTTCAGGACGAGAGGGG - Intergenic
1076240637 10:128902977-128902999 TGCAAGGCTCAGGGTGGGATTGG - Intergenic
1077207443 11:1351846-1351868 TGGGAGGCCTAGGAGGGGAGTGG - Intergenic
1085013468 11:73157485-73157507 TGCAAGGCAAAGGAGGGTAGAGG - Intergenic
1088596048 11:111441014-111441036 TCCCAGGCTTAGGCTGGGAGTGG + Intronic
1089401974 11:118169541-118169563 TGCAAGCCTGAGGAAGGTAGGGG - Intronic
1089619128 11:119712503-119712525 TGCAAGGCTTAGGACGGGAGAGG + Intronic
1090128615 11:124116223-124116245 TGCAAGGCTTAGGTAGAGACTGG - Intronic
1090169621 11:124588539-124588561 TGAAATACTTAGGATGGGAGGGG + Intergenic
1090422999 11:126588558-126588580 TGCAAGGCTTAGGACTCCAAAGG - Intronic
1090626075 11:128610040-128610062 GGCAAGGATGAGGCCGGGAGCGG + Intergenic
1091621979 12:2095806-2095828 TGGAAGGTTTAGGAGTGGAGAGG + Intronic
1092154688 12:6274536-6274558 AGCAAGGCCCAGGATGGGAGGGG + Intergenic
1094729443 12:33157822-33157844 TGCAATGTTTTGGATGGGAGAGG + Intergenic
1099810161 12:87570225-87570247 TACAGGGCATAGGAGGGGAGAGG - Intergenic
1101502781 12:105319727-105319749 TGCAAGGCATAGAAAGGGAAAGG + Intronic
1101727004 12:107396052-107396074 TCCCAGGCTTAGGCCAGGAGGGG - Intronic
1103792729 12:123483139-123483161 TCCAAGGCTTAGTACAGAAGAGG - Intronic
1104417036 12:128604069-128604091 GGAAAGGCTTTGGATGGGAGAGG - Intronic
1104520119 12:129466423-129466445 TGAGAGGCTTAGGACGGGGGCGG - Intronic
1105024690 12:132840032-132840054 TGCAGGGGTGAGGCCGGGAGGGG - Intronic
1107186251 13:37524575-37524597 TGTATGGCCTAGGACGGGACGGG - Intergenic
1108430987 13:50353418-50353440 TGAAAGGCTTGGGAGAGGAGGGG + Intronic
1108554689 13:51581627-51581649 TGAAAGGCTTATGAAGAGAGAGG - Intergenic
1109689770 13:65870625-65870647 TGAAAGGCTTAGAGCAGGAGTGG - Intergenic
1110643631 13:77855351-77855373 TGCAAGAATTTGGAGGGGAGAGG + Intergenic
1113930028 13:113963369-113963391 GGCGAGGCTGAGGACGGGAGAGG - Intergenic
1113930101 13:113963643-113963665 GGCAAGGCTGAGGACGGGCGAGG - Intergenic
1114029868 14:18568340-18568362 TGCATTGCTTTGGATGGGAGAGG - Intergenic
1115985678 14:39102363-39102385 TCCATGGCTTTGGACGGTAGAGG + Intronic
1117230122 14:53708301-53708323 TAAAAGACTAAGGACGGGAGTGG + Intergenic
1119329481 14:73783440-73783462 GCCGAGGGTTAGGACGGGAGAGG + Intronic
1122854603 14:104554155-104554177 TCCCAGGCTGAGGACTGGAGGGG - Intronic
1127078967 15:55357020-55357042 GGGAAGGCTAAGGACAGGAGTGG - Intronic
1127652298 15:61021133-61021155 TCCAACGCTGGGGACGGGAGAGG + Intronic
1127698024 15:61470753-61470775 TGCAAGGTCTAGGAGTGGAGTGG + Intergenic
1131424548 15:92334918-92334940 GGCAAGCCTTAGGAGGGCAGGGG - Intergenic
1131765611 15:95672492-95672514 TGAAAGGCTTAGTATCGGAGTGG + Intergenic
1132784053 16:1644668-1644690 TGGAAGCCTCAGGAGGGGAGGGG + Intronic
1137757337 16:50913095-50913117 TGCAAGGCTCTGTAAGGGAGAGG - Intergenic
1140020090 16:71230417-71230439 GGGAAGGCTGAGGAGGGGAGGGG + Intronic
1140624114 16:76771147-76771169 TGCAAGCTTTGGGACTGGAGGGG + Intergenic
1144362407 17:14507879-14507901 TGCAAGGCATAGATCTGGAGGGG + Intergenic
1146438157 17:32870783-32870805 TGCAAGGCTTTGGAAGGGGAAGG - Intronic
1146476473 17:33166641-33166663 TGCAAGGATGAGGCCAGGAGGGG - Intronic
1146721548 17:35127525-35127547 TTCACGGTTTAGGAAGGGAGAGG + Intronic
1148519712 17:48261120-48261142 TGCAAGTCCTAGGAGGGCAGGGG + Intronic
1152375798 17:79918395-79918417 TGCATGGCTTGGGAAGGGAGGGG - Intergenic
1152386382 17:79977304-79977326 TACAAGGCTGAGGAGGGGATGGG + Intronic
1152967180 18:127809-127831 TGGAAGGCTTAGGTGGGGGGAGG - Intergenic
1155635699 18:27952596-27952618 GCCAAGGCTTATGAAGGGAGGGG + Intronic
1156473536 18:37391984-37392006 TGCAAGGCTGAGAACCAGAGGGG + Intronic
1160032449 18:75274142-75274164 TGCTAGGCTCAGGAAGGGTGGGG + Intronic
1161679951 19:5675030-5675052 TGCCAGGATGAGGACGGGAGGGG + Intronic
1162141580 19:8588636-8588658 GGAAAGGCTTACTACGGGAGGGG - Intronic
1162665232 19:12204759-12204781 TGCAAGGGTTAGGACGAGGTAGG + Intergenic
1162908229 19:13835975-13835997 TGCCAGGCTTGGGAGAGGAGGGG + Intergenic
1164740960 19:30575386-30575408 AGCAAGGCTCTGGATGGGAGGGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1167428503 19:49441657-49441679 TGGAAGGCTCAGGAGGGGACAGG - Intronic
1167787831 19:51650316-51650338 TGCAATGCTTGGGAGGTGAGAGG + Intergenic
1167982312 19:53285000-53285022 TGAAAGGCTGAGAAGGGGAGAGG + Intergenic
1167983833 19:53298973-53298995 TGAAAGGCTGAGAAGGGGAGAGG - Intergenic
1168404323 19:56102981-56103003 TGCAAGGCCCAGGGCGGGAGGGG + Intronic
925189088 2:1868618-1868640 TTGAAGGCTTAGGAAGGGAAGGG + Intronic
925478718 2:4247288-4247310 GGCAAGGCATAGGACTGAAGAGG - Intergenic
925640761 2:5984108-5984130 TGAAATGCTGAGGAGGGGAGGGG - Intergenic
928238334 2:29564712-29564734 TGCAGGCCTCAGGAAGGGAGGGG + Intronic
928371230 2:30741661-30741683 TGCAGAGCTTAGAAAGGGAGGGG - Intronic
931100770 2:58998588-58998610 TGCAAGGGTGAGGATGGGATGGG - Intergenic
932230924 2:70083681-70083703 TGCAGGTCTGAGGAAGGGAGTGG + Intergenic
933698387 2:85237126-85237148 AGCACGTCTTAGGACTGGAGAGG + Intronic
935710276 2:105892593-105892615 TGGAAGGCTGAGGCTGGGAGGGG + Intronic
937931379 2:127208067-127208089 TTCAAGACTTAGTATGGGAGAGG + Intronic
939099162 2:137874670-137874692 TGTAAGACTTAGGATGGCAGTGG - Intergenic
941644690 2:168027295-168027317 GGCAAGGGTTTGGAGGGGAGGGG - Intronic
942624460 2:177884563-177884585 AGCAAGGCTGAGGACCAGAGAGG + Intronic
947860077 2:233352495-233352517 TGCAAGGCGGAGGAGGGGCGGGG - Intergenic
1171823581 20:29876088-29876110 GGCAAGGCGGAGGACCGGAGGGG + Intergenic
1172083087 20:32358131-32358153 TGCTAGGCGGAGGACGCGAGAGG + Intergenic
1172353211 20:34260209-34260231 AGCAAGGCTTAGGATGGGGAAGG - Intronic
1172870727 20:38134045-38134067 GGCAAGGCTTAGGAGGCCAGAGG + Intronic
1174416151 20:50368583-50368605 TGGAAGGCTTATGGCAGGAGAGG - Intergenic
1175324038 20:58110310-58110332 GGCAAGGCTCAGGATGTGAGGGG - Intergenic
1178171454 21:30045039-30045061 AACAAAGCTTAGGCCGGGAGTGG + Intergenic
1179720455 21:43313465-43313487 TGCCACACTTAGGAGGGGAGGGG + Intergenic
1180453984 22:15495390-15495412 TGCATTGCTTTGGATGGGAGAGG - Intergenic
949907167 3:8867396-8867418 TGTTAGGCTTGGGAGGGGAGAGG - Intronic
952174492 3:30846926-30846948 AGCAGGGCTTAGGCCAGGAGAGG - Intronic
952860095 3:37805961-37805983 TAAAAGGCTTAGGCCGGGCGGGG - Intronic
953544291 3:43852462-43852484 TGCAAGGCAGAGTACTGGAGAGG - Intergenic
956019283 3:64916305-64916327 AGCAAGGCTTAGGAGGAGAATGG + Intergenic
956354613 3:68377695-68377717 TGCAAGGCCTGTGATGGGAGGGG - Intronic
956665187 3:71635688-71635710 TACAGGGCTTATGAAGGGAGTGG - Intergenic
961714556 3:128849664-128849686 TGAAAGGATAAGGAGGGGAGTGG - Intergenic
963780492 3:149481500-149481522 TGCTAGGCTTGGGAAGGGAGTGG - Intronic
968001239 3:195208305-195208327 TGCTAGGCACAGGAGGGGAGGGG - Intronic
977150559 4:93506568-93506590 TGAAAGACTCAGGACAGGAGTGG + Intronic
977603402 4:98957920-98957942 TGTAAAGCTTAGGCCGGGCGCGG - Intergenic
982465040 4:155719791-155719813 TTCTAGGCTTAGGAAAGGAGGGG - Intronic
984781491 4:183530248-183530270 TGGCTGGATTAGGACGGGAGTGG + Intergenic
987230934 5:15892825-15892847 ATCAAGGCTTAGGCCGGGCGCGG + Intronic
988849489 5:35164797-35164819 TGCCAGGATTAGGATGGTAGCGG + Intronic
991556677 5:67902509-67902531 TGCAAGGCTTGGAGAGGGAGAGG + Intergenic
993506593 5:88716103-88716125 GGCCATGCTTAGGACAGGAGAGG + Intergenic
995594998 5:113738566-113738588 TGGAAGGCTAAAGATGGGAGTGG + Intergenic
995845084 5:116484877-116484899 TGCATGGCAGAGGATGGGAGGGG + Intronic
999279132 5:150353432-150353454 TGGAAGGCTTTGGAAGGCAGTGG - Intergenic
999377690 5:151098114-151098136 TGCAAGGCTCAAGGCAGGAGGGG + Intergenic
1001597237 5:172906193-172906215 GGGAAGCCTTAGGATGGGAGAGG - Intronic
1002337292 5:178488831-178488853 TGCCAGGCTTAGGAAGGAAGAGG + Intronic
1004587797 6:17019577-17019599 TGCAAGGGTTAGTTTGGGAGAGG + Intergenic
1006911857 6:37568368-37568390 TGGAAGGCCTGGGACAGGAGAGG + Intergenic
1007834426 6:44663840-44663862 TGAAAGGATCAGGACAGGAGGGG + Intergenic
1013822942 6:114177068-114177090 TGCAATTCTGAGGACAGGAGAGG - Intronic
1015804989 6:137099912-137099934 TGCAAGGTTTAGGAAGTGAGGGG - Intergenic
1016274976 6:142338296-142338318 TACAAGGCATAGGCCGGGCGCGG - Intronic
1017624347 6:156332866-156332888 TGCCAGGCATAGTAGGGGAGGGG + Intergenic
1021905207 7:25326555-25326577 TGGAGGGCTGGGGACGGGAGAGG + Intergenic
1022043410 7:26602431-26602453 TGCCAGGCATAGGATGGGGGGGG + Intergenic
1024321866 7:48078967-48078989 TGCCAGGCTTAGGGTTGGAGTGG + Intergenic
1033248062 7:139735461-139735483 TGCTAGGCTGAGGACTGTAGAGG + Intronic
1034995955 7:155577457-155577479 TGCAGGGCTGAGGAGGGGCGGGG + Intergenic
1035226782 7:157438175-157438197 AGCATGGCTCAGGAGGGGAGGGG - Intergenic
1037535321 8:19817814-19817836 AGCAAGGTGTAGGATGGGAGGGG - Intronic
1038157414 8:25002882-25002904 TGCAATGCTTAGCACAGGGGTGG + Intergenic
1038444270 8:27592722-27592744 TGCAGGGCCGAGGAAGGGAGGGG + Intergenic
1042424585 8:68632614-68632636 TGCCAGGCTTGCGATGGGAGGGG - Intronic
1048528220 8:135224158-135224180 TGCAAGGCCTGGGAAGGGTGTGG + Intergenic
1051493533 9:17693771-17693793 GGCAAGGCTTTTGATGGGAGAGG + Intronic
1053749144 9:41235570-41235592 GGCAAGGCGGAGGACCGGAGGGG - Intergenic
1054254581 9:62800423-62800445 GGCAAGGCGGAGGACCGGAGGGG - Intergenic
1054336722 9:63815179-63815201 GGCAAGGCGGAGGACCGGAGGGG + Intergenic
1056523435 9:87421251-87421273 TGCAAGGATTAAGAAGGAAGAGG - Intergenic
1056713053 9:89007228-89007250 TGGAAGGCTCAGGATGGGGGTGG - Intergenic
1057871536 9:98721868-98721890 TGCCAGGCCTTGGACCGGAGGGG - Intergenic
1060247178 9:121956920-121956942 AGCAAGGCGTAGGACTGGATGGG - Intronic
1062409444 9:136415435-136415457 TGCAAGGCTGAGGAGGGTAATGG - Intronic
1062504313 9:136865622-136865644 TACAGGGCTTAGGACAGGGGTGG - Intronic
1192591751 X:72366155-72366177 TGGAAAGCTCAGGAAGGGAGGGG - Intronic
1195450043 X:105000998-105001020 TGCAAGGCTAAGGACTCCAGTGG - Intronic
1197728988 X:129794437-129794459 TTCTAGGCTTAGGACGGGTTGGG + Exonic
1199043983 X:143147399-143147421 TTCCAGGCTTATGATGGGAGGGG - Intergenic
1200707665 Y:6456592-6456614 TGCGAGGCTCAGGATGGGTGGGG - Intergenic
1200795974 Y:7341704-7341726 TGCAGGGCTCAGGAGGGCAGAGG + Intergenic
1201026447 Y:9708116-9708138 TGCGAGGCTCAGGATGGGTGGGG + Intergenic
1201065407 Y:10090952-10090974 TGCAAGGAGGAGGACCGGAGGGG - Intergenic