ID: 1089620940

View in Genome Browser
Species Human (GRCh38)
Location 11:119721803-119721825
Sequence GGGCCAGGGAAGCAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 434}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089620940_1089620950 24 Left 1089620940 11:119721803-119721825 CCAGGACACTGCTTCCCTGGCCC 0: 1
1: 0
2: 2
3: 42
4: 434
Right 1089620950 11:119721850-119721872 TCCTCTATTCTACACCAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 106
1089620940_1089620947 -1 Left 1089620940 11:119721803-119721825 CCAGGACACTGCTTCCCTGGCCC 0: 1
1: 0
2: 2
3: 42
4: 434
Right 1089620947 11:119721825-119721847 CCCAGGAACGTTCCATTGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 88
1089620940_1089620952 25 Left 1089620940 11:119721803-119721825 CCAGGACACTGCTTCCCTGGCCC 0: 1
1: 0
2: 2
3: 42
4: 434
Right 1089620952 11:119721851-119721873 CCTCTATTCTACACCAACCTGGG 0: 1
1: 0
2: 0
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089620940 Original CRISPR GGGCCAGGGAAGCAGTGTCC TGG (reversed) Intronic
900243187 1:1626422-1626444 GAGCCATGGGAGGAGTGTCCAGG - Intronic
900406117 1:2493756-2493778 CGTCCAGCGAGGCAGTGTCCAGG + Intronic
900714279 1:4133878-4133900 GAGCCAGGGAAGGAGTGGGCCGG - Intergenic
900967329 1:5967782-5967804 GGAGCAGGGAGGCAGTGCCCTGG + Intronic
900970268 1:5988780-5988802 GGGCCAAGGATGCAGCGTCTGGG - Intronic
900970282 1:5988829-5988851 GGGCCAAGGATGCAGCGTCTGGG - Intronic
901120259 1:6885965-6885987 GGACATGGGAAGCAGTGCCCAGG - Intronic
901317065 1:8316598-8316620 GGGACAGGGATGCAGAGGCCTGG - Intergenic
901807312 1:11746916-11746938 GGGCAAGGGAAGGAGTCTCAGGG + Intronic
901917577 1:12511720-12511742 GGGCTGGGGAAGCACTGGCCTGG - Exonic
902292894 1:15446801-15446823 GGGCCAAGGAAGGAGCCTCCTGG + Intronic
902517019 1:16995028-16995050 GGGCCGGGTAGGCAGTGGCCTGG - Intronic
902782182 1:18711926-18711948 GGGGCAGGGGAGCAGTCTCTGGG - Intronic
903230829 1:21921496-21921518 GGGGCAGGGAAGCAGGGGCTTGG - Intronic
903304143 1:22400910-22400932 GAGCCTGAGAAGCAGTGGCCAGG + Intergenic
905394885 1:37660775-37660797 GGGTCAGGGAGGGAGTGTCTCGG + Intergenic
905397637 1:37677291-37677313 GGGCCAGGGGAGCAATGCCGAGG + Intergenic
905931177 1:41788636-41788658 GGTCCAGGTAATCAGTGCCCTGG + Intronic
905937317 1:41834911-41834933 GGGACAGGAGAGCAGTGACCAGG + Intronic
906694781 1:47816625-47816647 GGATCAGGGAAGGAGTGTGCAGG - Intronic
907120026 1:52000243-52000265 GGGCCAGGGAAGCAGACACAGGG - Intergenic
907369701 1:53992813-53992835 GGGCCAGGGCAGCAGGGGGCTGG + Intergenic
910676439 1:89821151-89821173 GGGCCGCGGGAGCAGGGTCCAGG + Exonic
910933115 1:92462230-92462252 GGGCCAGGGCAGGAGTATACAGG + Intergenic
911497739 1:98651187-98651209 GGGCCAAGGCAGCAGGGCCCTGG + Intergenic
912753941 1:112308828-112308850 GGGGAAGGGAAGCAGGGCCCAGG + Intergenic
913502783 1:119487456-119487478 GGGCTAGGAAAACAGTTTCCAGG + Intergenic
913568666 1:120098822-120098844 ATGCCAAGAAAGCAGTGTCCAGG - Intergenic
914289481 1:146259843-146259865 ATGCCAAGAAAGCAGTGTCCAGG - Intergenic
914550517 1:148710596-148710618 ATGCCAAGAAAGCAGTGTCCAGG - Intergenic
915185164 1:154098972-154098994 GGGCCAAGGCAGCAGGGGCCTGG + Intronic
915514622 1:156405668-156405690 GGGCTGGGGAAGCTATGTCCAGG + Intronic
917048564 1:170891583-170891605 TGGCCAGGGAAGAAGTGTAGGGG - Intergenic
918424646 1:184395884-184395906 TGGCAATGTAAGCAGTGTCCTGG - Intronic
920298974 1:204976846-204976868 CAGCCAGAGAAGCAGTGGCCCGG + Intronic
921247659 1:213261634-213261656 TGGCAAGGTAAGCAGTGGCCTGG + Exonic
921299277 1:213735197-213735219 GGATCAGGGAAGCATTCTCCTGG - Intergenic
921921536 1:220675651-220675673 GGGCCAGGTGGGCAGTTTCCAGG + Intergenic
922350592 1:224732065-224732087 TGGCCTGGGAAGCAGTGTAAAGG + Intronic
923394149 1:233544033-233544055 GAACCAGGGAGGCAGTATCCTGG + Intergenic
923684564 1:236144963-236144985 GAGCAAGGGAAACAGTGACCAGG + Intronic
924502580 1:244651480-244651502 TGGCCAGGGAAGGATAGTCCGGG + Intergenic
1062854395 10:772463-772485 GGGCCAGGGAAGCCCTGCTCTGG - Intergenic
1062882197 10:988112-988134 GGGCCAGGGTTGGAGGGTCCGGG - Exonic
1062937566 10:1399738-1399760 GTGCCAGGGAACCACTGACCAGG + Intronic
1063415450 10:5869435-5869457 GGGCCTGAGAAGCACTGCCCAGG + Intronic
1063422050 10:5920761-5920783 GGGCGAAGGAAGCAGGGTCTTGG + Intronic
1063422557 10:5924926-5924948 GGGAAAGGGGAGCAGAGTCCTGG + Intronic
1063846114 10:10128452-10128474 GGGCCCAGTAAGCAGTGACCTGG + Intergenic
1064202856 10:13299556-13299578 GGCCCAGGCAGGCAGTGACCGGG - Intronic
1064501372 10:15977119-15977141 GGACCAGAGAAACAGTGTCTGGG - Intergenic
1066313070 10:34217185-34217207 GGGACAGGGAAGCAGTGAGGTGG - Intronic
1067346415 10:45441815-45441837 GGACCCGGGAAGCAGAGTGCTGG - Intronic
1067416348 10:46106222-46106244 GGGCCAGGGGAGCGGGGGCCAGG + Intergenic
1067809453 10:49416078-49416100 GGGTGAGGGGAGCAGTGTCATGG - Intergenic
1069793803 10:71039944-71039966 GACCCAGGGAAGCAGGGACCTGG - Intergenic
1069813917 10:71181468-71181490 GTGACAGGGAAGCAGTGATCAGG + Intergenic
1069858392 10:71454570-71454592 TGGCACGGGCAGCAGTGTCCAGG + Intronic
1070106096 10:73432817-73432839 GAACCAGGGAAGCTGTGTCTGGG - Intronic
1070586805 10:77772634-77772656 GGGTCAGGGAAGCAGTGGCAGGG + Intergenic
1070961264 10:80501817-80501839 GACCCAGGCAAGCACTGTCCTGG + Intronic
1071956863 10:90770096-90770118 GGGCCAGGGCTTCAGAGTCCTGG - Intronic
1072610402 10:97013990-97014012 GCGTCAGGGCAGCAGTGTCTGGG - Intronic
1073154420 10:101335157-101335179 GGGAGAGGAAAGCAGTCTCCAGG - Intergenic
1073206267 10:101770955-101770977 GGGCCAGGGAACCGAAGTCCTGG - Intronic
1073654612 10:105399656-105399678 GGCCAAGGGAAGCAGTGTCAGGG + Intergenic
1075055836 10:119217764-119217786 CGGCCAGGGAAGCAGGGTGCAGG - Intronic
1075446720 10:122518445-122518467 GGTCCAGGGCAGCAGTGAGCAGG - Intergenic
1075605449 10:123802108-123802130 GGGACAGGGGAGCAGAGGCCAGG + Intronic
1076569914 10:131425825-131425847 TGGCCCCGGAAGCAGGGTCCAGG - Intergenic
1076840052 10:133041391-133041413 GGTCCAGGAAGGCAGGGTCCGGG + Intergenic
1076840071 10:133041447-133041469 GGTCCAGGAAGGCAGGGTCCGGG + Intergenic
1076840099 10:133041518-133041540 GGTCCAGGAAGGCAGGGTCCGGG + Intergenic
1076840264 10:133041978-133042000 GGTCCAGGAAGGCAGGGTCCGGG + Intergenic
1076868774 10:133182559-133182581 CGTCCTGGGAAGAAGTGTCCAGG + Intronic
1077361801 11:2144198-2144220 GCGCCCGGGAAGCAGCGTCCTGG - Intronic
1077429822 11:2510853-2510875 GGGCCAGGGGAGCAGAGTGATGG - Intronic
1077442077 11:2573590-2573612 GGCCTAGGGAAGCAGGGACCCGG + Intronic
1077474969 11:2782050-2782072 GGGAAAGGGTAGCAGTGTCTGGG - Intronic
1077549926 11:3195685-3195707 GGCCCAAGGCAGAAGTGTCCTGG - Intergenic
1080766977 11:35306034-35306056 TTGCCAGGGAAGCAGAATCCCGG + Intronic
1081986135 11:47305778-47305800 GTTCCAGGGAAGCAGGGTACTGG + Intronic
1083163131 11:60867775-60867797 TGGCCAGGGAGGCAGGGGCCAGG - Intronic
1083480005 11:62937977-62937999 GGGCCAGGGAGTCAGGGTCAAGG - Intronic
1083939211 11:65886275-65886297 GGGCCCAGGAAGTAGTGTGCGGG + Intronic
1084342907 11:68519963-68519985 GTGCCCTGGAAGCAGTGGCCTGG - Intronic
1084476676 11:69393436-69393458 AGGCCTGGGAAGCACTGGCCTGG + Intergenic
1084501112 11:69536039-69536061 GGGCCAGGCAAGAAGTGGTCTGG - Intergenic
1085036347 11:73302509-73302531 GGCCCAGGGATGGAGTTTCCAGG + Intergenic
1085252673 11:75153866-75153888 GGCCCAGAGAATCTGTGTCCTGG + Intronic
1085391041 11:76182361-76182383 GGGCCTGGGAAGCGCAGTCCAGG - Intergenic
1085414820 11:76313011-76313033 GGACCTGGGAAGAAGTGCCCAGG + Intergenic
1085635823 11:78158884-78158906 GGGCCAGGGATGCAGTATCTGGG - Intergenic
1087116378 11:94529287-94529309 GGGCCAGGGATGCAGCCTCTGGG + Intergenic
1088451632 11:109987517-109987539 AGGAGAGGGAAGCAGTGGCCAGG + Intergenic
1088740359 11:112762181-112762203 GGGCCAGGGAAGCTTTCTGCAGG + Intergenic
1088871673 11:113895595-113895617 GGGCCAGTAACACAGTGTCCTGG - Intergenic
1089135652 11:116247022-116247044 GGAAGAGGGAAGCATTGTCCAGG - Intergenic
1089620940 11:119721803-119721825 GGGCCAGGGAAGCAGTGTCCTGG - Intronic
1089697780 11:120226498-120226520 GGGCCAGGCAAGCTGTGCCAGGG - Intronic
1090028259 11:123185680-123185702 GGGCCAGGCAGGCAGAGTCCGGG - Intronic
1090189296 11:124758230-124758252 GGGCCGGGGAAGGAGTTTCAGGG - Intronic
1092238224 12:6822625-6822647 GGGCCAGGGAGGAAGAGTCAAGG + Intronic
1092240057 12:6830698-6830720 GGGACAGGGAAGCTGCGACCAGG - Exonic
1092938243 12:13383916-13383938 AGGCCAGGGAAGCGGGGTGCAGG - Intronic
1092950657 12:13500061-13500083 GAGCCAGGGAAGAAGTTGCCAGG + Intergenic
1094572812 12:31656449-31656471 GGGCCAGGAAAGCTGTGGTCAGG + Intronic
1095051025 12:37554482-37554504 GGTGCAGGGCAGCAGTGCCCAGG + Intergenic
1095489479 12:42718177-42718199 CTGCAAGGGAAGCAGTGTCTGGG - Intergenic
1096200262 12:49676468-49676490 GGTCCATGGTATCAGTGTCCTGG - Intronic
1096818836 12:54218196-54218218 GAGCCAGGGGAGCCGGGTCCGGG - Intergenic
1097198085 12:57255348-57255370 GGGACAGGGAATCAGAATCCTGG + Intronic
1098174391 12:67775714-67775736 GAGCCAGGTAAACAGGGTCCAGG + Intergenic
1101365300 12:104064818-104064840 CGCCCAAGGAAGCAGTGACCGGG - Intronic
1101693694 12:107104808-107104830 GGGCCAGGGAAGTAGTGGACTGG - Intergenic
1101746174 12:107543615-107543637 GGGCGAGGGAGGCAGTATGCAGG + Intronic
1102058653 12:109915595-109915617 GGCCCAGGGGAGCAGGGGCCGGG - Intronic
1102734217 12:115143827-115143849 AGTGCAGGGAAGCAGTGTGCAGG - Intergenic
1102878847 12:116468586-116468608 GTGACAAGGAAGCAGTGTCTTGG + Intergenic
1103727081 12:123003317-123003339 GTGCCAGGACAGCGGTGTCCTGG - Intronic
1104127473 12:125861636-125861658 GGGGCGGGGAAGGAGCGTCCGGG - Intergenic
1104895720 12:132162692-132162714 GAGCCAGGGAAGCAGCCTCCTGG + Intergenic
1105605646 13:21924501-21924523 GGGCCAGGGGACCTGTCTCCAGG - Intergenic
1106308842 13:28535326-28535348 GGGCCAAGGAAGCAGGGGGCTGG - Intergenic
1109780674 13:67106905-67106927 GGGCCAAGGCTGCAGTGTGCTGG - Intronic
1113417524 13:110139880-110139902 GGTCCAGGGATGCAATGTCACGG - Intergenic
1113755426 13:112808075-112808097 GGGCCAGAGAGGCAGCGGCCGGG + Intronic
1113961439 13:114128476-114128498 GGGCCAGGGAGGCACAGTCCAGG + Intronic
1114492906 14:23114293-23114315 GGGGCAGGGAAGCTGAATCCAGG + Intergenic
1117842051 14:59870448-59870470 GGGCCCGGGAAGCGGCGTCGCGG - Exonic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1118775543 14:68971806-68971828 GGACCAAGGAGGCAGTTTCCAGG + Intronic
1118961647 14:70538773-70538795 GGGCTAGGAAAACAGTTTCCAGG - Intergenic
1119028017 14:71169189-71169211 GGTCCAGGGCAGCAGTGTCATGG - Intergenic
1119649145 14:76371482-76371504 GGGCTAGGGCAGGTGTGTCCAGG - Intronic
1121006742 14:90495585-90495607 GGGCCAAGGAGGGAGAGTCCGGG + Intergenic
1121327115 14:93027542-93027564 GGGCCAGGGAGGCAGACTCTGGG + Intronic
1121608483 14:95259199-95259221 GGGCTAGGAAAGCAGTGGGCCGG + Intronic
1121630279 14:95416780-95416802 GGGCCAGGGATCGAGGGTCCAGG - Intronic
1122127204 14:99585880-99585902 GGTCCAGGGAAGAAGGGTCTTGG - Intronic
1122143929 14:99677697-99677719 GGGCCAGGCAAGCAGGGCCCTGG - Exonic
1122282234 14:100630160-100630182 GGGCTGGGGAAGGGGTGTCCTGG - Intergenic
1123023522 14:105412964-105412986 GGGCCAGGGATCCTGTGTCAGGG - Exonic
1123494765 15:20814570-20814592 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1123551260 15:21383663-21383685 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1124396988 15:29310613-29310635 GGGGCAGGGAAGAATTGTCCGGG + Intronic
1125883309 15:43211105-43211127 GGGAAAGGAAAGCAGGGTCCTGG + Intronic
1126778762 15:52120538-52120560 GGCCCAGGGAAGCACATTCCAGG - Exonic
1128128763 15:65211667-65211689 GGGCCAGGTGGGCAGTGGCCTGG + Intergenic
1132410824 15:101577179-101577201 GGGCCAGGGATGCAGAGAGCCGG - Intergenic
1202959601 15_KI270727v1_random:110906-110928 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1132590169 16:723136-723158 GGGCCCAGGATGCAGCGTCCAGG + Exonic
1132926510 16:2432475-2432497 GGGCCAACGCAGGAGTGTCCAGG - Intronic
1133027960 16:2996880-2996902 GGGACAGGGAGGCAGGGGCCAGG - Intergenic
1135990925 16:27218315-27218337 GGGGCAGGGCCGCAGTGGCCTGG - Intronic
1136501240 16:30670499-30670521 GGTTCAGGGAAGCAGGGCCCAGG - Exonic
1137286822 16:47023076-47023098 GGTCAAGGAAAGCAGTGTCCTGG + Intergenic
1137793637 16:51196381-51196403 GGTCCAGGGGAACAGTGTGCTGG + Intergenic
1138346975 16:56326105-56326127 GGGCCAGGACAGGAGTGTGCTGG - Intronic
1138351709 16:56349448-56349470 GGCCCAGTGAACCTGTGTCCAGG - Intronic
1138446091 16:57065122-57065144 GGGCCGGGGGAGGAGTGTCAAGG - Intronic
1138551695 16:57752227-57752249 GGGCCAGGGAACCAGAGCCAGGG - Intronic
1139690135 16:68635918-68635940 GAGCCTGGGAAGCAGTCTGCAGG + Intergenic
1139884122 16:70196810-70196832 AGGCCAGGGAAGCAGAGGGCAGG - Intergenic
1139940203 16:70600048-70600070 GGGACAGAGAAGCCGTGTCAGGG - Intronic
1140368396 16:74398686-74398708 AGGCCAGGGAAGCAGAGGGCAGG + Intergenic
1140410408 16:74737623-74737645 GGGCCAGGGAAACTGGGCCCCGG + Intronic
1141168729 16:81677795-81677817 GGGGCAGGAGAGCAGAGTCCTGG + Intronic
1141428169 16:83956981-83957003 GGGAAATGGAAGCAGTGGCCAGG - Intronic
1141498517 16:84426988-84427010 GAGCAAGGGAAGCAGAGGCCGGG + Intronic
1141655408 16:85413337-85413359 GGGCCATGGAGGGAGGGTCCAGG + Intergenic
1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG + Exonic
1142004270 16:87681838-87681860 GGTGCTGGGATGCAGTGTCCTGG + Intronic
1142123756 16:88400069-88400091 GGTGAAGGGAGGCAGTGTCCGGG + Intergenic
1142441112 16:90098159-90098181 GTGCCAGGCAAGGGGTGTCCAGG - Intergenic
1142563810 17:826752-826774 GCACCAGGGAAGCAATGCCCAGG + Intronic
1143172350 17:4937663-4937685 GGTCCAGGGCAGCAGAGCCCAGG + Exonic
1143180734 17:4982511-4982533 GGGCCTGGGCATCAGTGTTCTGG + Intronic
1143251834 17:5528491-5528513 GGGGCAGGGAAATAGAGTCCCGG - Intronic
1143381826 17:6501457-6501479 GGGCCAGGGAAGTATTGGCTTGG - Intronic
1144066738 17:11631106-11631128 GGACCAGAGAAGCATTTTCCAGG + Intronic
1145371638 17:22311306-22311328 GGTGCAGGGCAGCAGTGCCCAGG + Intergenic
1145741795 17:27281025-27281047 GGGCCAGGGAGACAGAGTGCTGG + Intergenic
1145901869 17:28494969-28494991 GGCCCAGGGATGCCGTGTCAGGG - Intronic
1146599651 17:34203672-34203694 TGTCCAAAGAAGCAGTGTCCAGG - Intergenic
1146733218 17:35213435-35213457 AAGACAAGGAAGCAGTGTCCAGG + Intergenic
1147159663 17:38562759-38562781 GGTCCAGGGGAGCAGGGTCTGGG - Intronic
1147201735 17:38806821-38806843 GCACCAGGGAAGCAGGGTCCCGG - Exonic
1147643941 17:42022518-42022540 GTGCAAGAGAAGCAGTGTCGGGG - Exonic
1148049272 17:44761094-44761116 GGGCCGGGGATGGGGTGTCCTGG + Intronic
1148062468 17:44846305-44846327 GGGTCAGGGAAGCAGTGACTTGG - Intergenic
1148846819 17:50534375-50534397 GGGCCAGGGCAGCCAGGTCCAGG + Intronic
1148861089 17:50604666-50604688 GGGCCAGGTTAGCAGCGTGCTGG + Intronic
1148902843 17:50891529-50891551 GGGCCAGGGAGTTAGTGTCGGGG - Intergenic
1149039328 17:52169242-52169264 TGACCATGGAAGCAGTGGCCAGG - Intergenic
1149561170 17:57608919-57608941 GGGGCAGGAGAGCAGTGACCAGG + Intronic
1149945141 17:60917313-60917335 GGGCCTGGGAAACAGAGTACTGG - Intronic
1150137560 17:62704066-62704088 AGGACAGGGCAGCAGGGTCCCGG - Intronic
1151260900 17:72915252-72915274 GGGCGAGAGAAATAGTGTCCCGG - Intronic
1151479257 17:74360834-74360856 CAGCCAGGGAACCAGTGTCAAGG + Intronic
1151834281 17:76573096-76573118 GGGCTATGGCAGCAGTGGCCTGG - Intronic
1152011784 17:77723452-77723474 TTGCCAAGGAAGCAGTGCCCTGG + Intergenic
1152129399 17:78466934-78466956 GGGCCTGGGCAGCACAGTCCTGG + Intronic
1152516263 17:80826596-80826618 GGGGCAGGGAAGCACCGCCCTGG + Intronic
1153682895 18:7517295-7517317 GGGACAGGGGAGGAGTGTGCAGG + Intergenic
1154452168 18:14487091-14487113 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1156498244 18:37540252-37540274 GGGCCAGGGAGCCAGTGGACGGG - Intronic
1156694236 18:39747694-39747716 TGGCCAGTGAAGCAGTGTTGGGG + Intergenic
1157416638 18:47508955-47508977 GGCCCAGGGAAAGAGTGGCCAGG - Intergenic
1157490030 18:48116683-48116705 GGGCCAGGCAAGCAGTGGCCAGG - Intronic
1157588641 18:48821109-48821131 GGGCCTAGGAAGAAGTGTCAGGG - Intronic
1157992184 18:52510424-52510446 AGGCAAGGCAAGCAGTGTCATGG - Intronic
1158533060 18:58280654-58280676 GGGGCAGGGAAGCAGTATTGTGG + Intronic
1160690340 19:458484-458506 GGGACGGGGAAGCAGGTTCCGGG + Intronic
1160919260 19:1512209-1512231 GAGCCAGGGAAACAGGGTCCAGG - Intronic
1161021818 19:2014579-2014601 GGTCCAGGGATGGAGCGTCCTGG + Intronic
1161070154 19:2255918-2255940 GGGGCAGGGGAGGAGGGTCCCGG + Intronic
1161479936 19:4505398-4505420 GGGCCCGGGAAGCAGGCTCCCGG - Intronic
1162070045 19:8147911-8147933 GGGGAAGGGCAGCAGGGTCCCGG + Intronic
1162667723 19:12229263-12229285 GGGCTAGGAAAACAGTTTCCAGG + Intronic
1162923471 19:13918066-13918088 GGGCCAGGGCTGCAGGGACCTGG - Exonic
1163120459 19:15214134-15214156 GTCCCAGGGAAGCAGTGTCCAGG - Intergenic
1163784125 19:19265923-19265945 CGGCCAGGGAAGTAGGGACCAGG - Intronic
1165140833 19:33699010-33699032 AGGCCAGGAAACCAGTATCCTGG + Intronic
1165367820 19:35380139-35380161 GGGCCAGGGAAGAAGTCTGCAGG - Intergenic
1165449717 19:35874983-35875005 GGGGCAGAGAAGCGGTGTTCAGG - Intronic
1165743660 19:38217825-38217847 CCTCCAGGGAAGCGGTGTCCTGG + Exonic
1165937432 19:39397859-39397881 GGGGCAGGGACGCAGGGGCCCGG - Exonic
1165994146 19:39832909-39832931 GGGGCAAGGAAGCAGTGTAGGGG - Intronic
1166104513 19:40590703-40590725 GGGGCACGGAAGCAGGGTCAGGG - Intronic
1166748927 19:45155620-45155642 AGGCCAGAGAAGCAGAGCCCGGG + Intronic
1166758871 19:45212311-45212333 GGACCGGGGAAGCAGGGCCCCGG - Intronic
1166851087 19:45761675-45761697 GGGCCTTGGAGGCTGTGTCCTGG - Exonic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1167095657 19:47373761-47373783 GGGAAGGGGAAGCAGTGTTCTGG - Intronic
1167333246 19:48869059-48869081 GGGCCAGGGACGGTTTGTCCAGG + Intergenic
925702245 2:6650484-6650506 GGGACATGGAAGCTGTGTTCAGG - Intergenic
926139016 2:10357423-10357445 GGGCCAGGGAAGCTGTGGCAGGG + Intronic
927247391 2:20968476-20968498 GAGCTAGGCAAGCAGTGGCCAGG - Intergenic
928361197 2:30663586-30663608 GTGCCAGGCAAGCCATGTCCTGG + Intergenic
929057478 2:37890977-37890999 GGGCTGAGGCAGCAGTGTCCAGG + Intergenic
929244103 2:39683487-39683509 TGGACAGGGAAGCTGTGTCCTGG - Intronic
929258538 2:39839508-39839530 GGGCCATGGCTGCAGTGTTCAGG + Intergenic
929599931 2:43198631-43198653 GGGCCAGGGAGGCTGGGTCAGGG - Intergenic
929605071 2:43228049-43228071 GGCCCAGGGAGCCAGAGTCCAGG + Intergenic
929792563 2:45034383-45034405 GAGGCAGGGAAGCAGCCTCCCGG + Intergenic
931664637 2:64601388-64601410 TGGCCAGGACAGCAGTGGCCAGG - Intergenic
932331014 2:70898363-70898385 GGGGTAGGGGTGCAGTGTCCAGG + Intergenic
934089988 2:88542847-88542869 GTGCCTGGGAGGCAGTGTCAGGG + Intergenic
934638847 2:96013993-96014015 GGACCAGGGCAGCTGTGTCAGGG - Intergenic
934857626 2:97738996-97739018 GGGCCAGGGTATCAGTGTGCTGG - Intronic
935691110 2:105733281-105733303 GGGGCAGGGCAGCAGTGCCAGGG - Intergenic
936089991 2:109495315-109495337 GGGCCAGGCAAGCTGAGTTCTGG + Intronic
936458504 2:112693691-112693713 GGGCGAGGGAAGGAATGACCCGG + Intergenic
936965861 2:118127231-118127253 GGGCCAAGGAGGCAGAGCCCAGG - Intergenic
937669954 2:124527937-124527959 GGGCCAGAGAAGCAGTGGTAGGG - Intronic
940957015 2:159738991-159739013 GGGCCAAGGTAGCAGTGGGCTGG + Intronic
941701128 2:168605645-168605667 AAGGCAGGGAAGCAGGGTCCTGG - Intronic
946023062 2:216654990-216655012 GGCCCACAGAGGCAGTGTCCAGG - Intronic
947473166 2:230415988-230416010 GGACCAGGGAAGGAGGGCCCAGG - Intronic
947876208 2:233469789-233469811 AGGCCAGGCAAGCAGTGCCCAGG - Exonic
948257597 2:236579172-236579194 GGGTCAGGGGATCAGGGTCCGGG - Intronic
948663415 2:239520365-239520387 GGGCCTGGGGAGCAGGGACCCGG - Intergenic
1169255231 20:4091878-4091900 GGGCAAGGGAAGCAGCTGCCAGG + Intergenic
1170150477 20:13221635-13221657 GGGCCCGGGAAGCGGAGCCCTGG + Intergenic
1171312951 20:24160363-24160385 GGGCAAAGGAAGCCCTGTCCTGG - Intergenic
1172005311 20:31815573-31815595 GAGCCAAGGAAGCAGTGCCTGGG + Intergenic
1172693629 20:36807126-36807148 GGGCCAGGGCAGCAGGGTGTGGG + Intronic
1173498618 20:43536301-43536323 AGGCCAGGGAATCAGGGCCCGGG + Intronic
1173502632 20:43565294-43565316 GGACCAGGGAGGCCGGGTCCTGG + Intronic
1174081223 20:47971977-47971999 GGGTCTGGGAATCACTGTCCTGG - Intergenic
1174135277 20:48374911-48374933 GGGTCTGGGAATCACTGTCCTGG + Intergenic
1174365528 20:50054114-50054136 GGGCCAGGGAGGCAGTGGGATGG + Intergenic
1175269729 20:57725372-57725394 TGGCGTGGGAAGCAGTGGCCAGG - Intergenic
1175372431 20:58500943-58500965 GAGCCTGGGTAGCAGTGGCCAGG - Intronic
1175604719 20:60303346-60303368 GGGACAGGGAGGCAGAGTCTTGG - Intergenic
1175879077 20:62246218-62246240 GGCCCCGGGACGCTGTGTCCAGG + Intronic
1175905243 20:62376449-62376471 GGGCCTGGGGAGCCCTGTCCAGG - Intergenic
1175913223 20:62414361-62414383 AGGCCAGAGAAGCAGAGGCCTGG - Exonic
1176061868 20:63176015-63176037 GGGCCAGGGAGGCCGGCTCCCGG - Intergenic
1176145365 20:63563045-63563067 CGGCCTGAGAAGCAGTCTCCGGG + Exonic
1176275392 20:64263358-64263380 GGGCCAGGGAAGCCTTGGCCTGG + Intronic
1176443857 21:6801209-6801231 GGGGCGGGGAAGCAGCATCCTGG + Intergenic
1176822024 21:13666248-13666270 GGGGCAGGGAAGCAGCATCCTGG + Intergenic
1176871240 21:14084535-14084557 GGGCCAGGGAAGGAGGTCCCCGG + Intergenic
1178931117 21:36820146-36820168 GGGCCCAGGGAGCAGTGGCCTGG + Intronic
1179487824 21:41722249-41722271 GCGCTAGGGAAGAGGTGTCCGGG + Intergenic
1179885182 21:44310846-44310868 GGGCCTGGGTAACAGGGTCCGGG - Intronic
1180197386 21:46206047-46206069 TGGTCAGGGAGGCAGCGTCCGGG - Intronic
1180839759 22:18953845-18953867 GGGCCATGGTAGCAGAGACCTGG - Intergenic
1180897938 22:19350919-19350941 GTGCCTGGGAAGGAGTGACCAGG - Intronic
1180984583 22:19896938-19896960 GGGCGAGGGACCCTGTGTCCTGG - Intronic
1181062141 22:20286634-20286656 GGGCCATGGTAGCAGAGACCTGG + Intergenic
1181337029 22:22144454-22144476 GAGCCAAGAAAGCAGTGTGCAGG - Intergenic
1181481791 22:23204635-23204657 CAGCCAGCAAAGCAGTGTCCTGG - Intronic
1181751206 22:24990470-24990492 GGGCCAGGGAACATGTTTCCAGG - Intronic
1182079667 22:27520034-27520056 GGACCAGGGAAGGGGTGACCTGG + Intergenic
1182103052 22:27670954-27670976 GGGCAAGAGAGGCAGGGTCCTGG - Intergenic
1182230742 22:28835848-28835870 GGCCCAGGGAAGCAGGGTTGGGG + Intergenic
1182316097 22:29448475-29448497 AGGCCAGGGAGGCAGGGCCCAGG - Intergenic
1183441838 22:37827447-37827469 GGCCCTGGGGAGCAGTGGCCAGG - Intergenic
1183505588 22:38207024-38207046 GGGCTAGGGAAACAGGGCCCAGG + Intronic
1183709054 22:39491792-39491814 GGGACATGGCAGCAGTGTGCCGG - Exonic
1184562135 22:45269337-45269359 GGGCCGGGAGAGCAGGGTCCTGG - Intergenic
1184616080 22:45639672-45639694 GGGCCAGGGAGACAGCGTCTTGG + Intergenic
1184918301 22:47588375-47588397 GGCCCAGGGCATCAGTGTCCAGG - Intergenic
1184993578 22:48186425-48186447 GGGCCGGGGGAACAGTCTCCAGG + Intergenic
1185025286 22:48405392-48405414 GACCCAGGGAGGCAGTTTCCCGG + Intergenic
1185037467 22:48487192-48487214 GGGCCTGGAAACCAGTCTCCTGG + Intergenic
1185085719 22:48740049-48740071 GGGCATGGGCAGCAGTGTCCAGG - Intronic
1185244379 22:49765457-49765479 GGGCCATGATAGCAGGGTCCTGG - Intergenic
1185340483 22:50288677-50288699 GGGCCTGGGATGCAATGACCGGG + Intronic
949127411 3:462996-463018 AGGCCAGCTAAGCAGAGTCCTGG - Intergenic
949408675 3:3741058-3741080 GAGCCAGGGAAGCAGCTTCAGGG - Intronic
950265254 3:11568686-11568708 ACGCCTGGGAAGCAGTGGCCGGG - Intronic
950467320 3:13163068-13163090 GCTCCAGGGAACCAGAGTCCAGG - Intergenic
950633842 3:14301582-14301604 GGGCAAAGGAACCGGTGTCCCGG - Intergenic
951943820 3:28111961-28111983 GGGCAAGGGAAGCAACTTCCAGG + Intergenic
952301308 3:32106669-32106691 CGGCCAGGGAAGCACGGTCCAGG + Exonic
953026738 3:39149691-39149713 GGGAGAGGGAAGCAGTGGCCAGG - Intronic
954420271 3:50415231-50415253 CTGCCAGAGAAGCAGTGTCCTGG + Intronic
955213787 3:56966558-56966580 TGGACAGGGAAGCAGAGTCAGGG + Intronic
956378796 3:68644481-68644503 GGGGCAGGGCAGCAGTGGCGAGG + Intergenic
956486788 3:69731575-69731597 GGGCAAGGGCAGCTGTGTACTGG + Intergenic
958584529 3:96069287-96069309 AGGCTAAGGCAGCAGTGTCCTGG + Intergenic
960697235 3:120408044-120408066 GCCCCTGGGAAGGAGTGTCCTGG + Intronic
961406007 3:126680003-126680025 GGCCCAGGGAAGCTGTGACCTGG + Intergenic
963556966 3:146803992-146804014 GGGCCAGGAAAGCAGGGCCATGG - Intergenic
964478106 3:157115296-157115318 GGGATTGAGAAGCAGTGTCCTGG + Intergenic
964711417 3:159675549-159675571 GGGCCTGGAAGGCAGTTTCCTGG - Intronic
965075572 3:163970979-163971001 GGGCCAAGGGAGCAGGGTCATGG + Intergenic
965157476 3:165082678-165082700 AGGCAAGGAAAGCATTGTCCTGG - Intergenic
965442367 3:168730147-168730169 GGGCCATGGAGGCAGTCTCCTGG + Intergenic
968027615 3:195455793-195455815 GGCTCAGGGTGGCAGTGTCCTGG - Intergenic
968361375 3:198149132-198149154 GTGCCAGGCAAGGGGTGTCCAGG - Intergenic
968480113 4:829478-829500 GGGTCTGGGAAGCACTGTCAGGG + Intergenic
968610006 4:1552609-1552631 GGGCCTGGGAGCCAGTGGCCAGG + Intergenic
968747040 4:2365496-2365518 GGGCCAGGGAGGCAGGGCCGGGG - Intronic
968805540 4:2769259-2769281 GGGACTGGTAAGCAGTGACCTGG - Intergenic
968912256 4:3482356-3482378 GGCCCAGGAAAGCACTGTGCCGG + Intronic
968915283 4:3494565-3494587 AGGCCAGGGAAGCCGGGCCCGGG - Intronic
968933580 4:3597467-3597489 AGGCTGGGGAAGCAGAGTCCAGG + Intergenic
968971793 4:3799560-3799582 GGGCCAGAGCAGAGGTGTCCTGG - Intergenic
969307791 4:6335673-6335695 GGGCCAGGGCTGCAGAGCCCAGG + Intronic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
970411228 4:15809698-15809720 GGGACAGGGAGACAGTGTCACGG - Intronic
972106406 4:35494220-35494242 GGGCCAGGGAAGCAGAGAGCTGG - Intergenic
972386852 4:38575178-38575200 TAGCCAGGGAAGCAGGGTCCTGG + Intergenic
972591530 4:40492725-40492747 GGACCAGGGAAGCATTTTCTTGG - Intronic
975681525 4:76881652-76881674 GGAACAGGGAACCAGTTTCCTGG + Intergenic
975718436 4:77227736-77227758 GGCCCAGGGAAGCCATTTCCTGG - Intronic
976299488 4:83504755-83504777 GGGGCAAGGAAGCAGTCACCTGG + Intronic
982015609 4:151150588-151150610 GGTCCAAGAAAGCAGTGTGCTGG + Intronic
1202762008 4_GL000008v2_random:120816-120838 AGACCACGGAAGCAGTGTTCTGG + Intergenic
985668765 5:1195776-1195798 GGGCCAGGGAAGCAGTTCTCAGG - Intergenic
986576993 5:9222464-9222486 AGGCCAGGGAAGGAGTGTGGGGG + Intronic
986855764 5:11866891-11866913 GTGTCAGGGAGGCAGTGTCTTGG - Intronic
990168125 5:53017824-53017846 GGGCCAGCAAAGCAGTGTTGGGG + Intronic
990546027 5:56822544-56822566 GCGCCACGGAAGAAGTGTCATGG - Intronic
991015295 5:61925719-61925741 GGGTCAGGAAAGCAGTGTTGTGG - Intergenic
991173296 5:63654349-63654371 GGGCCAAGGAAGCAGTGGATGGG - Intergenic
992168939 5:74083327-74083349 GGGCCAGGGAAGCAAAGTTATGG + Intergenic
993091803 5:83435362-83435384 GTTCCAGGGAAGCATTGTTCTGG - Intergenic
993689573 5:90982779-90982801 TGGCCAGGGGAGCAATGTCAGGG + Intronic
995320879 5:110832331-110832353 GGGCCACAGGAGCAGAGTCCAGG - Intergenic
995332979 5:110966422-110966444 GGGCCTGGGGTGCAGTGTCTTGG - Intergenic
997200017 5:132004251-132004273 GTGTCAGAGAAGCAGTGTTCTGG - Intronic
998140540 5:139697357-139697379 GGGCCAGGGAAGGAGAGACGTGG - Intergenic
998204523 5:140149318-140149340 GGGCCTGGGCAGCAGAGCCCTGG + Intergenic
998224433 5:140315564-140315586 GCCCCTGGGAAGCAGAGTCCTGG - Intergenic
999249568 5:150174254-150174276 TGGCCAGGGGGGCAGTGGCCTGG + Intronic
999350411 5:150864848-150864870 GGGACAGGGAAACAGAGTCAGGG + Intronic
1000945418 5:167417293-167417315 GGGCCAGGGATGGACTGTGCTGG - Intronic
1001114830 5:168930824-168930846 GGCCAAGGGACTCAGTGTCCTGG - Intronic
1001601377 5:172931036-172931058 GGGGCAGGGAGGGAGTGTCAGGG + Intronic
1001975324 5:175994030-175994052 GGGCCACAGTAGGAGTGTCCAGG - Intronic
1002045699 5:176540709-176540731 GGGACAGGGCAGCGGTTTCCTGG - Intergenic
1002098199 5:176844398-176844420 GTGCCAGGGAAGGAGAGGCCAGG + Intronic
1002134355 5:177098728-177098750 GGGCCAGGGAAGGAGGTTCCAGG - Intergenic
1002242109 5:177849740-177849762 GGGCCACAGTAGGAGTGTCCAGG + Intergenic
1003277198 6:4662796-4662818 GGGTCTGGGTTGCAGTGTCCTGG - Intergenic
1003347606 6:5285243-5285265 GGCCAAAGGGAGCAGTGTCCAGG + Intronic
1004664906 6:17740838-17740860 GCCCCAGGGAAGCAGAGTGCTGG + Intergenic
1005941452 6:30563265-30563287 GGGCCAGGGAGGCAGTCTGATGG - Exonic
1005989221 6:30892914-30892936 GGGCTGGGGGAGCAGGGTCCTGG - Intronic
1005995827 6:30930803-30930825 GGGCCAGGGGAACCATGTCCTGG + Intergenic
1007429550 6:41768804-41768826 AGGCCCAGGCAGCAGTGTCCTGG + Intergenic
1012824506 6:104129972-104129994 GGGCAAGGGTAGCAGTGACAGGG - Intergenic
1016443249 6:144106530-144106552 TGGACATGGAAGCAGTGGCCAGG + Intergenic
1017523891 6:155226146-155226168 GGGGCAGGGAGACAGGGTCCAGG - Intronic
1017950111 6:159129103-159129125 GGGCCAGTGCAGCGGTGTCCCGG - Intergenic
1017960381 6:159216349-159216371 GGGCAAAGGAAGCACTGGCCAGG + Intronic
1018941411 6:168310676-168310698 GGGCCAGGGCTGCAGAGTGCAGG - Intronic
1019013392 6:168861197-168861219 GGCGGAGGGAAGGAGTGTCCTGG - Intergenic
1019170398 6:170130374-170130396 GGGCCATCGACCCAGTGTCCGGG - Intergenic
1019254316 7:39589-39611 GTGCCAGGCAAGGGGTGTCCAGG + Intergenic
1019271243 7:150248-150270 AGGCCAGGGAAGGAGAGGCCAGG + Intergenic
1019301650 7:307220-307242 AGGCCAGGCAGGCAGGGTCCCGG - Intergenic
1019420244 7:947516-947538 GGGACGTGGGAGCAGTGTCCAGG - Intronic
1019486913 7:1293621-1293643 GGGCCAGGGAGGCAGTCCCTGGG - Intergenic
1019526975 7:1484888-1484910 GGGCCAGTGGTGCAGTGCCCTGG - Intronic
1019572734 7:1720482-1720504 GAGCCAGGGAACCAGCGTGCAGG + Intronic
1019614093 7:1951072-1951094 AGGCCAGGGGAGCAGCCTCCCGG - Intronic
1019721859 7:2577167-2577189 GGCCCAGGGAAGCACTGAGCTGG - Intronic
1020142939 7:5622413-5622435 GGGCCTGGGAAGCATTGCTCAGG - Intronic
1020278033 7:6636722-6636744 CGGGCAGGGAAGCGATGTCCAGG - Intergenic
1022537963 7:31109699-31109721 GGAGCAGGGAGGCAGTGTCAGGG + Exonic
1023768459 7:43533291-43533313 TTACCAGGGAAGCAGTGTCTGGG + Intronic
1023831345 7:44040459-44040481 GGACCAGGGAGGCTGTGTCCCGG - Intergenic
1026602158 7:71785818-71785840 GGGGCAGGCATGCAGTGTGCAGG + Exonic
1031989490 7:128188466-128188488 GGGCCAGCACACCAGTGTCCTGG + Intergenic
1032440671 7:131940802-131940824 GGAACAGGGAAGGAGTGTCCCGG - Intergenic
1033544983 7:142391632-142391654 GGGCTGGGGAATCAGTGTCAGGG + Intergenic
1033550760 7:142445461-142445483 GGGCTTGGGAATCAGTGTCAGGG + Intergenic
1033591016 7:142808681-142808703 GGGCCAGGGAACAGGTGTCAGGG - Intergenic
1035051168 7:155999689-155999711 AGTCCAGTGAAGGAGTGTCCGGG + Intergenic
1035140337 7:156753170-156753192 GGGACAGGCAAGGAGTGTCCTGG + Intronic
1035253760 7:157613506-157613528 GGCCCAGGAGAGCAGGGTCCGGG + Intronic
1035339696 7:158152362-158152384 GGGCCTGGGAAGCTGTCTTCAGG + Intronic
1035477393 7:159152924-159152946 AGGCAGGAGAAGCAGTGTCCCGG + Intergenic
1035818049 8:2562073-2562095 AGGGCAGGGAAGTTGTGTCCTGG - Intergenic
1036632316 8:10524451-10524473 TGGCCAGGAAGGCAGTGCCCAGG + Intergenic
1036676309 8:10836846-10836868 GTTCCAGGGAAGCAGGGTTCTGG - Intronic
1036769039 8:11566177-11566199 GGGCCGGGGAGGTGGTGTCCTGG - Intergenic
1037985480 8:23288333-23288355 GGGTCAGGGAAGGGGTCTCCTGG - Intronic
1038191890 8:25329916-25329938 GGGCCAGGAGAGCAGTGACACGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1040065270 8:43140179-43140201 GGGCGAGGGAAGAAGGCTCCTGG + Intergenic
1041023436 8:53660403-53660425 GGGCCTGGGAGGCAGTGCCAGGG - Intergenic
1041084941 8:54247939-54247961 GGGACTGGGAAGGACTGTCCAGG - Intergenic
1042804372 8:72755922-72755944 TGGCTGGGGAAGCTGTGTCCAGG + Intronic
1044631679 8:94285968-94285990 GGGCCAGAAAGGCAGTGTACTGG + Intergenic
1045336266 8:101206171-101206193 GGGCCGGGGCCGCGGTGTCCTGG - Intronic
1046867256 8:119164720-119164742 GGGTCAGGGAGGCAGTCTGCCGG + Intergenic
1047339687 8:123968930-123968952 AGGCCTGGGAAGCTGTTTCCTGG - Intronic
1048326467 8:133443020-133443042 GGGCGAGGGCAGCAGTATTCGGG - Intergenic
1048803648 8:138218869-138218891 GTGCCTGGTAAGCAGTTTCCTGG - Intronic
1049195328 8:141312674-141312696 GGGCCAGGGAAGCTGAGGGCAGG - Intergenic
1049201158 8:141341320-141341342 GGGGCAGGGAAACTGTGTCCAGG + Intergenic
1049413845 8:142486169-142486191 TGGGCAGAGAAGCAGGGTCCTGG - Intronic
1049527013 8:143132133-143132155 GGGTCAGAGAAGCTTTGTCCAGG - Intergenic
1049672941 8:143877816-143877838 AGGGCAGGGAAGCAGAGCCCTGG + Intronic
1050109569 9:2200552-2200574 GGGGCAGGGAATCAGGGCCCTGG + Intergenic
1050394853 9:5185335-5185357 GGGCCGGGGAAGCGGTTTGCGGG + Exonic
1051386539 9:16515279-16515301 GGCGCAGGGATGCAGTGTTCAGG - Intronic
1051669352 9:19494516-19494538 GGGTCAGGGCAGAAGTGGCCTGG + Intergenic
1052904041 9:33817951-33817973 CGGCCGCGGAAGCAGGGTCCGGG - Intronic
1054075563 9:60525668-60525690 AGGCCATGGTAGCAGTGTTCTGG + Intergenic
1054456567 9:65434350-65434372 AGGCTGGGGAAGCAGAGTCCAGG - Intergenic
1055514732 9:77023225-77023247 GGGCCTGGGAAGCCGCGTCCCGG + Intergenic
1055703311 9:78970532-78970554 GGGCCACGGGAGCAGTGTGGAGG - Intergenic
1056552764 9:87664839-87664861 GGGTCAGGGAGGCAATGTCAGGG - Intronic
1057221027 9:93257866-93257888 GGGCCAGGGCACCATTGCCCAGG + Intronic
1057805557 9:98217288-98217310 GGACCAGGGAAGCAGGAGCCCGG + Intronic
1058923715 9:109641337-109641359 GAGCCAGGGCTGCAATGTCCTGG + Intronic
1059494506 9:114698538-114698560 GGGCCAGAAAAGCAGCCTCCAGG - Intergenic
1060519994 9:124288872-124288894 GCTGCAGGGAGGCAGTGTCCTGG - Intronic
1061254019 9:129443231-129443253 GGGCCAGGGAAGCTGTGCTTGGG + Intergenic
1061284246 9:129613279-129613301 GGGCCGGGGACTCAGAGTCCAGG - Intronic
1061318831 9:129815048-129815070 GGGGCTGGGAGGAAGTGTCCTGG - Intronic
1061544859 9:131298768-131298790 TGGCCAGGGAACCAGAGTGCTGG - Intronic
1061644534 9:131990091-131990113 GGGCCAGGGAAGCACCGTCTGGG - Intronic
1061789044 9:133048956-133048978 GGGCCAAGGAGGCAGTGGCTAGG - Intronic
1061811493 9:133164748-133164770 GGGCCTGGGAGGCTGTGCCCAGG - Intergenic
1062100099 9:134723512-134723534 GAGCCACAGAAGCAGTGGCCAGG - Intronic
1062153974 9:135035965-135035987 GGGCCTGGGCAGCATGGTCCAGG + Intergenic
1062173037 9:135145830-135145852 GGGTCAGTGATGCAGTCTCCAGG - Intergenic
1203525343 Un_GL000213v1:83318-83340 GGGGCGGGGAAGCAGCATCCTGG - Intergenic
1203456391 Un_GL000219v1:171881-171903 AGGCCACGGTAGCAGTGTTCTGG + Intergenic
1185877945 X:3714754-3714776 GGGTCAGGGGCGCAGCGTCCAGG - Intergenic
1187390894 X:18886105-18886127 GGGCAAAGGAAACAGTGGCCGGG - Intergenic
1187518019 X:19990536-19990558 GGGCCGGGAAGGCGGTGTCCGGG - Intergenic
1193833903 X:86319957-86319979 GGGCCAGGAAGACAGTTTCCAGG + Intronic
1198100012 X:133415217-133415239 GGCCCAGGGAAGCAGAGGCGCGG + Exonic
1199724774 X:150568986-150569008 GGGACGGGGAAGCAAAGTCCAGG - Intronic
1199743887 X:150759866-150759888 GGGTCAGAGAAGCAGTGACTTGG + Intronic
1199984003 X:152937445-152937467 GGGCAAGCCAAGCTGTGTCCTGG + Intronic
1200080377 X:153573284-153573306 GGCCCTGGAAAGGAGTGTCCAGG - Intronic
1200787428 Y:7273040-7273062 GGGTCAGGGGAGCAGCGTCTAGG + Intergenic