ID: 1089622595

View in Genome Browser
Species Human (GRCh38)
Location 11:119730126-119730148
Sequence CAGAGTAAGGGGAAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089622595_1089622606 8 Left 1089622595 11:119730126-119730148 CCTTCCCTCTTCCCCTTACTCTG No data
Right 1089622606 11:119730157-119730179 ATCCCCATCCCCTCCCCCTGGGG No data
1089622595_1089622607 9 Left 1089622595 11:119730126-119730148 CCTTCCCTCTTCCCCTTACTCTG No data
Right 1089622607 11:119730158-119730180 TCCCCATCCCCTCCCCCTGGGGG No data
1089622595_1089622605 7 Left 1089622595 11:119730126-119730148 CCTTCCCTCTTCCCCTTACTCTG No data
Right 1089622605 11:119730156-119730178 TATCCCCATCCCCTCCCCCTGGG No data
1089622595_1089622604 6 Left 1089622595 11:119730126-119730148 CCTTCCCTCTTCCCCTTACTCTG No data
Right 1089622604 11:119730155-119730177 CTATCCCCATCCCCTCCCCCTGG No data
1089622595_1089622611 12 Left 1089622595 11:119730126-119730148 CCTTCCCTCTTCCCCTTACTCTG No data
Right 1089622611 11:119730161-119730183 CCATCCCCTCCCCCTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089622595 Original CRISPR CAGAGTAAGGGGAAGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr