ID: 1089625147

View in Genome Browser
Species Human (GRCh38)
Location 11:119746323-119746345
Sequence CTCCTGTTCTTTAGAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089625142_1089625147 4 Left 1089625142 11:119746296-119746318 CCACTGCTTTCTTCCAGGGTGCC No data
Right 1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG No data
1089625138_1089625147 14 Left 1089625138 11:119746286-119746308 CCAGGTACTCCCACTGCTTTCTT No data
Right 1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG No data
1089625137_1089625147 20 Left 1089625137 11:119746280-119746302 CCTATGCCAGGTACTCCCACTGC No data
Right 1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG No data
1089625141_1089625147 5 Left 1089625141 11:119746295-119746317 CCCACTGCTTTCTTCCAGGGTGC No data
Right 1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG No data
1089625143_1089625147 -9 Left 1089625143 11:119746309-119746331 CCAGGGTGCCCACACTCCTGTTC No data
Right 1089625147 11:119746323-119746345 CTCCTGTTCTTTAGAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089625147 Original CRISPR CTCCTGTTCTTTAGAAGAAA GGG Intergenic
No off target data available for this crispr