ID: 1089625455

View in Genome Browser
Species Human (GRCh38)
Location 11:119748226-119748248
Sequence GCTTGTTTCTGCCTCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089625455_1089625462 27 Left 1089625455 11:119748226-119748248 CCAGCTGGGAGGCAGAAACAAGC No data
Right 1089625462 11:119748276-119748298 GCTTTAGTGCAACTTGAAGGTGG No data
1089625455_1089625461 24 Left 1089625455 11:119748226-119748248 CCAGCTGGGAGGCAGAAACAAGC No data
Right 1089625461 11:119748273-119748295 GGTGCTTTAGTGCAACTTGAAGG No data
1089625455_1089625456 -8 Left 1089625455 11:119748226-119748248 CCAGCTGGGAGGCAGAAACAAGC No data
Right 1089625456 11:119748241-119748263 AAACAAGCCAGCTCAGCACAAGG No data
1089625455_1089625458 3 Left 1089625455 11:119748226-119748248 CCAGCTGGGAGGCAGAAACAAGC No data
Right 1089625458 11:119748252-119748274 CTCAGCACAAGGCCTCCTCAAGG No data
1089625455_1089625463 28 Left 1089625455 11:119748226-119748248 CCAGCTGGGAGGCAGAAACAAGC No data
Right 1089625463 11:119748277-119748299 CTTTAGTGCAACTTGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089625455 Original CRISPR GCTTGTTTCTGCCTCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr