ID: 1089625461

View in Genome Browser
Species Human (GRCh38)
Location 11:119748273-119748295
Sequence GGTGCTTTAGTGCAACTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089625455_1089625461 24 Left 1089625455 11:119748226-119748248 CCAGCTGGGAGGCAGAAACAAGC No data
Right 1089625461 11:119748273-119748295 GGTGCTTTAGTGCAACTTGAAGG No data
1089625457_1089625461 2 Left 1089625457 11:119748248-119748270 CCAGCTCAGCACAAGGCCTCCTC No data
Right 1089625461 11:119748273-119748295 GGTGCTTTAGTGCAACTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089625461 Original CRISPR GGTGCTTTAGTGCAACTTGA AGG Intergenic
No off target data available for this crispr