ID: 1089625515

View in Genome Browser
Species Human (GRCh38)
Location 11:119748529-119748551
Sequence CCTCACCTGGCCCAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089625508_1089625515 1 Left 1089625508 11:119748505-119748527 CCTGTGTTCTCTCCCTCTGCTCT No data
Right 1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG No data
1089625507_1089625515 6 Left 1089625507 11:119748500-119748522 CCGCTCCTGTGTTCTCTCCCTCT No data
Right 1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG No data
1089625506_1089625515 9 Left 1089625506 11:119748497-119748519 CCTCCGCTCCTGTGTTCTCTCCC No data
Right 1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089625515 Original CRISPR CCTCACCTGGCCCAGCTGGA GGG Intergenic
No off target data available for this crispr