ID: 1089630185

View in Genome Browser
Species Human (GRCh38)
Location 11:119779579-119779601
Sequence GCTCTGCTTCCCACCAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089630175_1089630185 21 Left 1089630175 11:119779535-119779557 CCTGCCCCGGGAGGGACATAGTT No data
Right 1089630185 11:119779579-119779601 GCTCTGCTTCCCACCAGAACAGG No data
1089630174_1089630185 25 Left 1089630174 11:119779531-119779553 CCTTCCTGCCCCGGGAGGGACAT No data
Right 1089630185 11:119779579-119779601 GCTCTGCTTCCCACCAGAACAGG No data
1089630176_1089630185 17 Left 1089630176 11:119779539-119779561 CCCCGGGAGGGACATAGTTCTGG No data
Right 1089630185 11:119779579-119779601 GCTCTGCTTCCCACCAGAACAGG No data
1089630178_1089630185 16 Left 1089630178 11:119779540-119779562 CCCGGGAGGGACATAGTTCTGGC No data
Right 1089630185 11:119779579-119779601 GCTCTGCTTCCCACCAGAACAGG No data
1089630179_1089630185 15 Left 1089630179 11:119779541-119779563 CCGGGAGGGACATAGTTCTGGCA No data
Right 1089630185 11:119779579-119779601 GCTCTGCTTCCCACCAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089630185 Original CRISPR GCTCTGCTTCCCACCAGAAC AGG Intergenic
No off target data available for this crispr