ID: 1089631496

View in Genome Browser
Species Human (GRCh38)
Location 11:119787272-119787294
Sequence CCTCCCAGGAGGGCTGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089631496_1089631503 -10 Left 1089631496 11:119787272-119787294 CCGCTCCCAGCCCTCCTGGGAGG No data
Right 1089631503 11:119787285-119787307 TCCTGGGAGGCCAAGGTAATTGG No data
1089631496_1089631506 22 Left 1089631496 11:119787272-119787294 CCGCTCCCAGCCCTCCTGGGAGG No data
Right 1089631506 11:119787317-119787339 TCAGCTCAATTAGCACCTTCTGG No data
1089631496_1089631507 23 Left 1089631496 11:119787272-119787294 CCGCTCCCAGCCCTCCTGGGAGG No data
Right 1089631507 11:119787318-119787340 CAGCTCAATTAGCACCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089631496 Original CRISPR CCTCCCAGGAGGGCTGGGAG CGG (reversed) Intergenic
No off target data available for this crispr