ID: 1089632373

View in Genome Browser
Species Human (GRCh38)
Location 11:119791781-119791803
Sequence TGGAGTATCAGTAGGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089632373_1089632382 5 Left 1089632373 11:119791781-119791803 CCTCCCCTCCTACTGATACTCCA No data
Right 1089632382 11:119791809-119791831 TCTGCGTACAGCAAACCGAGGGG No data
1089632373_1089632383 10 Left 1089632373 11:119791781-119791803 CCTCCCCTCCTACTGATACTCCA No data
Right 1089632383 11:119791814-119791836 GTACAGCAAACCGAGGGGACAGG No data
1089632373_1089632381 4 Left 1089632373 11:119791781-119791803 CCTCCCCTCCTACTGATACTCCA No data
Right 1089632381 11:119791808-119791830 CTCTGCGTACAGCAAACCGAGGG No data
1089632373_1089632386 23 Left 1089632373 11:119791781-119791803 CCTCCCCTCCTACTGATACTCCA No data
Right 1089632386 11:119791827-119791849 AGGGGACAGGAGGCCTCCCGTGG No data
1089632373_1089632384 13 Left 1089632373 11:119791781-119791803 CCTCCCCTCCTACTGATACTCCA No data
Right 1089632384 11:119791817-119791839 CAGCAAACCGAGGGGACAGGAGG No data
1089632373_1089632380 3 Left 1089632373 11:119791781-119791803 CCTCCCCTCCTACTGATACTCCA No data
Right 1089632380 11:119791807-119791829 CCTCTGCGTACAGCAAACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089632373 Original CRISPR TGGAGTATCAGTAGGAGGGG AGG (reversed) Intergenic
No off target data available for this crispr