ID: 1089634199

View in Genome Browser
Species Human (GRCh38)
Location 11:119801879-119801901
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089634196_1089634199 -7 Left 1089634196 11:119801863-119801885 CCTGCAGGGAGAAGGTCCGGAGT No data
Right 1089634199 11:119801879-119801901 CCGGAGTGAAGGCTTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089634199 Original CRISPR CCGGAGTGAAGGCTTTGAAG TGG Intergenic
No off target data available for this crispr