ID: 1089634535

View in Genome Browser
Species Human (GRCh38)
Location 11:119803863-119803885
Sequence CAGGGAAGGAAAGGTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089634535_1089634543 1 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634543 11:119803887-119803909 AGCCCTGCAGCATGAGGGGTAGG No data
1089634535_1089634555 29 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634555 11:119803915-119803937 TGGCCCTGGGCCGTGGCTGGGGG No data
1089634535_1089634552 26 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634552 11:119803912-119803934 GGCTGGCCCTGGGCCGTGGCTGG No data
1089634535_1089634546 4 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634546 11:119803890-119803912 CCTGCAGCATGAGGGGTAGGTGG No data
1089634535_1089634541 -4 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634541 11:119803882-119803904 CCTGTAGCCCTGCAGCATGAGGG No data
1089634535_1089634550 16 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634550 11:119803902-119803924 GGGGTAGGTGGGCTGGCCCTGGG No data
1089634535_1089634539 -5 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634539 11:119803881-119803903 CCCTGTAGCCCTGCAGCATGAGG No data
1089634535_1089634542 -3 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634542 11:119803883-119803905 CTGTAGCCCTGCAGCATGAGGGG No data
1089634535_1089634549 15 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634549 11:119803901-119803923 AGGGGTAGGTGGGCTGGCCCTGG No data
1089634535_1089634554 28 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634554 11:119803914-119803936 CTGGCCCTGGGCCGTGGCTGGGG No data
1089634535_1089634548 9 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634548 11:119803895-119803917 AGCATGAGGGGTAGGTGGGCTGG No data
1089634535_1089634551 22 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634551 11:119803908-119803930 GGTGGGCTGGCCCTGGGCCGTGG No data
1089634535_1089634553 27 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634553 11:119803913-119803935 GCTGGCCCTGGGCCGTGGCTGGG No data
1089634535_1089634547 5 Left 1089634535 11:119803863-119803885 CCAGAAACACCTTTCCTTCCCTG No data
Right 1089634547 11:119803891-119803913 CTGCAGCATGAGGGGTAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089634535 Original CRISPR CAGGGAAGGAAAGGTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr