ID: 1089640591

View in Genome Browser
Species Human (GRCh38)
Location 11:119844954-119844976
Sequence CTTGCTGGAAACTTGGGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089640591_1089640603 22 Left 1089640591 11:119844954-119844976 CCGAGACCCAAGTTTCCAGCAAG No data
Right 1089640603 11:119844999-119845021 GAGCAGTCAGGATCGTTGCCTGG No data
1089640591_1089640597 -7 Left 1089640591 11:119844954-119844976 CCGAGACCCAAGTTTCCAGCAAG No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data
1089640591_1089640598 10 Left 1089640591 11:119844954-119844976 CCGAGACCCAAGTTTCCAGCAAG No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089640591 Original CRISPR CTTGCTGGAAACTTGGGTCT CGG (reversed) Intergenic
No off target data available for this crispr