ID: 1089640595

View in Genome Browser
Species Human (GRCh38)
Location 11:119844961-119844983
Sequence CTCAGCCCTTGCTGGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089640595_1089640603 15 Left 1089640595 11:119844961-119844983 CCAAGTTTCCAGCAAGGGCTGAG No data
Right 1089640603 11:119844999-119845021 GAGCAGTCAGGATCGTTGCCTGG No data
1089640595_1089640598 3 Left 1089640595 11:119844961-119844983 CCAAGTTTCCAGCAAGGGCTGAG No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089640595 Original CRISPR CTCAGCCCTTGCTGGAAACT TGG (reversed) Intergenic
No off target data available for this crispr