ID: 1089640596

View in Genome Browser
Species Human (GRCh38)
Location 11:119844969-119844991
Sequence CAGGCAAGCTCAGCCCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089640596_1089640603 7 Left 1089640596 11:119844969-119844991 CCAGCAAGGGCTGAGCTTGCCTG No data
Right 1089640603 11:119844999-119845021 GAGCAGTCAGGATCGTTGCCTGG No data
1089640596_1089640598 -5 Left 1089640596 11:119844969-119844991 CCAGCAAGGGCTGAGCTTGCCTG No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640596_1089640606 28 Left 1089640596 11:119844969-119844991 CCAGCAAGGGCTGAGCTTGCCTG No data
Right 1089640606 11:119845020-119845042 GGCTGTGTTTCTTCCATAGGAGG No data
1089640596_1089640605 25 Left 1089640596 11:119844969-119844991 CCAGCAAGGGCTGAGCTTGCCTG No data
Right 1089640605 11:119845017-119845039 CCTGGCTGTGTTTCTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089640596 Original CRISPR CAGGCAAGCTCAGCCCTTGC TGG (reversed) Intergenic
No off target data available for this crispr