ID: 1089640597

View in Genome Browser
Species Human (GRCh38)
Location 11:119844970-119844992
Sequence CAGCAAGGGCTGAGCTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089640587_1089640597 10 Left 1089640587 11:119844937-119844959 CCAACCCTATCCACTGGCCGAGA No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data
1089640589_1089640597 5 Left 1089640589 11:119844942-119844964 CCTATCCACTGGCCGAGACCCAA No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data
1089640586_1089640597 13 Left 1089640586 11:119844934-119844956 CCTCCAACCCTATCCACTGGCCG No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data
1089640588_1089640597 6 Left 1089640588 11:119844941-119844963 CCCTATCCACTGGCCGAGACCCA No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data
1089640591_1089640597 -7 Left 1089640591 11:119844954-119844976 CCGAGACCCAAGTTTCCAGCAAG No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data
1089640585_1089640597 14 Left 1089640585 11:119844933-119844955 CCCTCCAACCCTATCCACTGGCC No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data
1089640583_1089640597 25 Left 1089640583 11:119844922-119844944 CCATTTCTCTTCCCTCCAACCCT No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data
1089640590_1089640597 0 Left 1089640590 11:119844947-119844969 CCACTGGCCGAGACCCAAGTTTC No data
Right 1089640597 11:119844970-119844992 CAGCAAGGGCTGAGCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089640597 Original CRISPR CAGCAAGGGCTGAGCTTGCC TGG Intergenic
No off target data available for this crispr