ID: 1089640598

View in Genome Browser
Species Human (GRCh38)
Location 11:119844987-119845009
Sequence GCCTGGTCCCCTGAGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089640595_1089640598 3 Left 1089640595 11:119844961-119844983 CCAAGTTTCCAGCAAGGGCTGAG No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640589_1089640598 22 Left 1089640589 11:119844942-119844964 CCTATCCACTGGCCGAGACCCAA No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640588_1089640598 23 Left 1089640588 11:119844941-119844963 CCCTATCCACTGGCCGAGACCCA No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640587_1089640598 27 Left 1089640587 11:119844937-119844959 CCAACCCTATCCACTGGCCGAGA No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640586_1089640598 30 Left 1089640586 11:119844934-119844956 CCTCCAACCCTATCCACTGGCCG No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640596_1089640598 -5 Left 1089640596 11:119844969-119844991 CCAGCAAGGGCTGAGCTTGCCTG No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640591_1089640598 10 Left 1089640591 11:119844954-119844976 CCGAGACCCAAGTTTCCAGCAAG No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640590_1089640598 17 Left 1089640590 11:119844947-119844969 CCACTGGCCGAGACCCAAGTTTC No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data
1089640594_1089640598 4 Left 1089640594 11:119844960-119844982 CCCAAGTTTCCAGCAAGGGCTGA No data
Right 1089640598 11:119844987-119845009 GCCTGGTCCCCTGAGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089640598 Original CRISPR GCCTGGTCCCCTGAGCAGTC AGG Intergenic
No off target data available for this crispr