ID: 1089640603

View in Genome Browser
Species Human (GRCh38)
Location 11:119844999-119845021
Sequence GAGCAGTCAGGATCGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089640594_1089640603 16 Left 1089640594 11:119844960-119844982 CCCAAGTTTCCAGCAAGGGCTGA No data
Right 1089640603 11:119844999-119845021 GAGCAGTCAGGATCGTTGCCTGG No data
1089640591_1089640603 22 Left 1089640591 11:119844954-119844976 CCGAGACCCAAGTTTCCAGCAAG No data
Right 1089640603 11:119844999-119845021 GAGCAGTCAGGATCGTTGCCTGG No data
1089640590_1089640603 29 Left 1089640590 11:119844947-119844969 CCACTGGCCGAGACCCAAGTTTC No data
Right 1089640603 11:119844999-119845021 GAGCAGTCAGGATCGTTGCCTGG No data
1089640596_1089640603 7 Left 1089640596 11:119844969-119844991 CCAGCAAGGGCTGAGCTTGCCTG No data
Right 1089640603 11:119844999-119845021 GAGCAGTCAGGATCGTTGCCTGG No data
1089640595_1089640603 15 Left 1089640595 11:119844961-119844983 CCAAGTTTCCAGCAAGGGCTGAG No data
Right 1089640603 11:119844999-119845021 GAGCAGTCAGGATCGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089640603 Original CRISPR GAGCAGTCAGGATCGTTGCC TGG Intergenic
No off target data available for this crispr