ID: 1089644156

View in Genome Browser
Species Human (GRCh38)
Location 11:119867016-119867038
Sequence GGTACCTTGATAGATGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089644156_1089644158 1 Left 1089644156 11:119867016-119867038 CCAGCAACATCTATCAAGGTACC No data
Right 1089644158 11:119867040-119867062 TGCTGCAAATGCCAAACACTTGG No data
1089644156_1089644160 13 Left 1089644156 11:119867016-119867038 CCAGCAACATCTATCAAGGTACC No data
Right 1089644160 11:119867052-119867074 CAAACACTTGGATGAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089644156 Original CRISPR GGTACCTTGATAGATGTTGC TGG (reversed) Intergenic
No off target data available for this crispr