ID: 1089645397

View in Genome Browser
Species Human (GRCh38)
Location 11:119875579-119875601
Sequence GACCCCAGGCTTCTCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089645397_1089645403 23 Left 1089645397 11:119875579-119875601 CCAGTGAGGAGAAGCCTGGGGTC No data
Right 1089645403 11:119875625-119875647 ATGCCTGTGCGTCTGGCCACTGG No data
1089645397_1089645402 16 Left 1089645397 11:119875579-119875601 CCAGTGAGGAGAAGCCTGGGGTC No data
Right 1089645402 11:119875618-119875640 TGGACACATGCCTGTGCGTCTGG No data
1089645397_1089645399 -4 Left 1089645397 11:119875579-119875601 CCAGTGAGGAGAAGCCTGGGGTC No data
Right 1089645399 11:119875598-119875620 GGTCTATCTCCACAGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089645397 Original CRISPR GACCCCAGGCTTCTCCTCAC TGG (reversed) Intergenic
No off target data available for this crispr