ID: 1089646334

View in Genome Browser
Species Human (GRCh38)
Location 11:119882245-119882267
Sequence ACTAAAGAGCTACGTAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089646334_1089646336 6 Left 1089646334 11:119882245-119882267 CCTCTCTTACGTAGCTCTTTAGT No data
Right 1089646336 11:119882274-119882296 GAAATTTATTTTGTGAATGGTGG No data
1089646334_1089646335 3 Left 1089646334 11:119882245-119882267 CCTCTCTTACGTAGCTCTTTAGT No data
Right 1089646335 11:119882271-119882293 TTTGAAATTTATTTTGTGAATGG No data
1089646334_1089646338 14 Left 1089646334 11:119882245-119882267 CCTCTCTTACGTAGCTCTTTAGT No data
Right 1089646338 11:119882282-119882304 TTTTGTGAATGGTGGGAAATAGG No data
1089646334_1089646339 15 Left 1089646334 11:119882245-119882267 CCTCTCTTACGTAGCTCTTTAGT No data
Right 1089646339 11:119882283-119882305 TTTGTGAATGGTGGGAAATAGGG No data
1089646334_1089646337 7 Left 1089646334 11:119882245-119882267 CCTCTCTTACGTAGCTCTTTAGT No data
Right 1089646337 11:119882275-119882297 AAATTTATTTTGTGAATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089646334 Original CRISPR ACTAAAGAGCTACGTAAGAG AGG (reversed) Intergenic
No off target data available for this crispr