ID: 1089646338

View in Genome Browser
Species Human (GRCh38)
Location 11:119882282-119882304
Sequence TTTTGTGAATGGTGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089646334_1089646338 14 Left 1089646334 11:119882245-119882267 CCTCTCTTACGTAGCTCTTTAGT No data
Right 1089646338 11:119882282-119882304 TTTTGTGAATGGTGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089646338 Original CRISPR TTTTGTGAATGGTGGGAAAT AGG Intergenic
No off target data available for this crispr