ID: 1089647465

View in Genome Browser
Species Human (GRCh38)
Location 11:119889651-119889673
Sequence GAGACTGCTCACTTCCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089647465_1089647468 5 Left 1089647465 11:119889651-119889673 CCGGGCAGGAAGTGAGCAGTCTC No data
Right 1089647468 11:119889679-119889701 CCCCATACCCATCCTCCCTCTGG No data
1089647465_1089647470 6 Left 1089647465 11:119889651-119889673 CCGGGCAGGAAGTGAGCAGTCTC No data
Right 1089647470 11:119889680-119889702 CCCATACCCATCCTCCCTCTGGG No data
1089647465_1089647475 18 Left 1089647465 11:119889651-119889673 CCGGGCAGGAAGTGAGCAGTCTC No data
Right 1089647475 11:119889692-119889714 CTCCCTCTGGGAGTCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089647465 Original CRISPR GAGACTGCTCACTTCCTGCC CGG (reversed) Intergenic
No off target data available for this crispr