ID: 1089647889

View in Genome Browser
Species Human (GRCh38)
Location 11:119892167-119892189
Sequence GGCTCTGATGTGCCTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089647886_1089647889 -1 Left 1089647886 11:119892145-119892167 CCTTGGGCTGCTTGGGCTTCTGG No data
Right 1089647889 11:119892167-119892189 GGCTCTGATGTGCCTCCCTCTGG No data
1089647885_1089647889 0 Left 1089647885 11:119892144-119892166 CCCTTGGGCTGCTTGGGCTTCTG No data
Right 1089647889 11:119892167-119892189 GGCTCTGATGTGCCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089647889 Original CRISPR GGCTCTGATGTGCCTCCCTC TGG Intergenic
No off target data available for this crispr