ID: 1089650342

View in Genome Browser
Species Human (GRCh38)
Location 11:119908752-119908774
Sequence CTCTGTTTGCCGAGAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089650340_1089650342 -8 Left 1089650340 11:119908737-119908759 CCATGTGTGTGTTTACTCTGTTT No data
Right 1089650342 11:119908752-119908774 CTCTGTTTGCCGAGAGAGGATGG No data
1089650338_1089650342 12 Left 1089650338 11:119908717-119908739 CCCTATGTCTAGGGAACTGACCA No data
Right 1089650342 11:119908752-119908774 CTCTGTTTGCCGAGAGAGGATGG No data
1089650339_1089650342 11 Left 1089650339 11:119908718-119908740 CCTATGTCTAGGGAACTGACCAT No data
Right 1089650342 11:119908752-119908774 CTCTGTTTGCCGAGAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089650342 Original CRISPR CTCTGTTTGCCGAGAGAGGA TGG Intergenic
No off target data available for this crispr