ID: 1089651262

View in Genome Browser
Species Human (GRCh38)
Location 11:119914935-119914957
Sequence CCACTAGGCCATAATCCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089651262_1089651268 5 Left 1089651262 11:119914935-119914957 CCTAGTGGATTATGGCCTAGTGG No data
Right 1089651268 11:119914963-119914985 GGACTCCAGACAAGAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089651262 Original CRISPR CCACTAGGCCATAATCCACT AGG (reversed) Intergenic
No off target data available for this crispr