ID: 1089652339

View in Genome Browser
Species Human (GRCh38)
Location 11:119922446-119922468
Sequence CTTTGTGAGCAGAGTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089652332_1089652339 6 Left 1089652332 11:119922417-119922439 CCAACTTTCCCCCTCTGTGGTGC No data
Right 1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG No data
1089652336_1089652339 -5 Left 1089652336 11:119922428-119922450 CCTCTGTGGTGCTTACACCTTTG No data
Right 1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG No data
1089652334_1089652339 -3 Left 1089652334 11:119922426-119922448 CCCCTCTGTGGTGCTTACACCTT No data
Right 1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG No data
1089652333_1089652339 -2 Left 1089652333 11:119922425-119922447 CCCCCTCTGTGGTGCTTACACCT No data
Right 1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG No data
1089652335_1089652339 -4 Left 1089652335 11:119922427-119922449 CCCTCTGTGGTGCTTACACCTTT No data
Right 1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG No data
1089652330_1089652339 23 Left 1089652330 11:119922400-119922422 CCTCGACGGGGTTAAATCCAACT No data
Right 1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089652339 Original CRISPR CTTTGTGAGCAGAGTGTGGC TGG Intergenic
No off target data available for this crispr