ID: 1089655891

View in Genome Browser
Species Human (GRCh38)
Location 11:119946698-119946720
Sequence AGGAGTCCAGGAGGACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089655886_1089655891 6 Left 1089655886 11:119946669-119946691 CCAGGGAAGTGGTGCCTAACATA No data
Right 1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG No data
1089655888_1089655891 -8 Left 1089655888 11:119946683-119946705 CCTAACATAGACAGAAGGAGTCC No data
Right 1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089655891 Original CRISPR AGGAGTCCAGGAGGACTTCC AGG Intergenic
No off target data available for this crispr