ID: 1089657706

View in Genome Browser
Species Human (GRCh38)
Location 11:119963657-119963679
Sequence CAGAGCTAGAACTCACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089657706_1089657712 21 Left 1089657706 11:119963657-119963679 CCTGTGTGTGAGTTCTAGCTCTG No data
Right 1089657712 11:119963701-119963723 TAGGAAAATCACTTAATCCCTGG No data
1089657706_1089657713 22 Left 1089657706 11:119963657-119963679 CCTGTGTGTGAGTTCTAGCTCTG No data
Right 1089657713 11:119963702-119963724 AGGAAAATCACTTAATCCCTGGG No data
1089657706_1089657709 -8 Left 1089657706 11:119963657-119963679 CCTGTGTGTGAGTTCTAGCTCTG No data
Right 1089657709 11:119963672-119963694 TAGCTCTGCTCTTACAGGGTAGG No data
1089657706_1089657710 2 Left 1089657706 11:119963657-119963679 CCTGTGTGTGAGTTCTAGCTCTG No data
Right 1089657710 11:119963682-119963704 CTTACAGGGTAGGTGACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089657706 Original CRISPR CAGAGCTAGAACTCACACAC AGG (reversed) Intergenic
No off target data available for this crispr