ID: 1089665534

View in Genome Browser
Species Human (GRCh38)
Location 11:120015841-120015863
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089665534_1089665541 -1 Left 1089665534 11:120015841-120015863 CCAAGAGCAAAAGGTCCAACTTG No data
Right 1089665541 11:120015863-120015885 GGGAGCCGGGGATACACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089665534 Original CRISPR CAAGTTGGACCTTTTGCTCT TGG (reversed) Intergenic
No off target data available for this crispr