ID: 1089665774

View in Genome Browser
Species Human (GRCh38)
Location 11:120017737-120017759
Sequence CTCAAAGATATGCAAATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089665770_1089665774 26 Left 1089665770 11:120017688-120017710 CCAGAGAGGGAATGGAAGCTCTG No data
Right 1089665774 11:120017737-120017759 CTCAAAGATATGCAAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089665774 Original CRISPR CTCAAAGATATGCAAATCCA AGG Intergenic
No off target data available for this crispr