ID: 1089666762

View in Genome Browser
Species Human (GRCh38)
Location 11:120025604-120025626
Sequence CACTCTACAGGGATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089666751_1089666762 16 Left 1089666751 11:120025565-120025587 CCCATCTTAAGGCAAAGGCACTG No data
Right 1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG No data
1089666752_1089666762 15 Left 1089666752 11:120025566-120025588 CCATCTTAAGGCAAAGGCACTGG No data
Right 1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089666762 Original CRISPR CACTCTACAGGGATGGGGGA AGG Intergenic
No off target data available for this crispr