ID: 1089667775

View in Genome Browser
Species Human (GRCh38)
Location 11:120031299-120031321
Sequence GTCTCACTGGAGAACGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089667775_1089667782 5 Left 1089667775 11:120031299-120031321 CCTGTCCCGTTCTCCAGTGAGAC No data
Right 1089667782 11:120031327-120031349 ACGCAGCCGAGCTTTGCTGTGGG No data
1089667775_1089667785 18 Left 1089667775 11:120031299-120031321 CCTGTCCCGTTCTCCAGTGAGAC No data
Right 1089667785 11:120031340-120031362 TTGCTGTGGGGTTCAAATCCCGG No data
1089667775_1089667783 6 Left 1089667775 11:120031299-120031321 CCTGTCCCGTTCTCCAGTGAGAC No data
Right 1089667783 11:120031328-120031350 CGCAGCCGAGCTTTGCTGTGGGG No data
1089667775_1089667781 4 Left 1089667775 11:120031299-120031321 CCTGTCCCGTTCTCCAGTGAGAC No data
Right 1089667781 11:120031326-120031348 GACGCAGCCGAGCTTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089667775 Original CRISPR GTCTCACTGGAGAACGGGAC AGG (reversed) Intergenic
No off target data available for this crispr