ID: 1089670382

View in Genome Browser
Species Human (GRCh38)
Location 11:120052677-120052699
Sequence AGGGAGGAGCAGATTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089670368_1089670382 30 Left 1089670368 11:120052624-120052646 CCTCAGGGAACCCTGCTGCAGTG No data
Right 1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG No data
1089670372_1089670382 19 Left 1089670372 11:120052635-120052657 CCTGCTGCAGTGAAAGGGATGCA No data
Right 1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG No data
1089670379_1089670382 -10 Left 1089670379 11:120052664-120052686 CCAAACAGGGTTAAGGGAGGAGC No data
Right 1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG No data
1089670378_1089670382 -9 Left 1089670378 11:120052663-120052685 CCCAAACAGGGTTAAGGGAGGAG No data
Right 1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG No data
1089670371_1089670382 20 Left 1089670371 11:120052634-120052656 CCCTGCTGCAGTGAAAGGGATGC No data
Right 1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089670382 Original CRISPR AGGGAGGAGCAGATTGTGGT GGG Intergenic
No off target data available for this crispr