ID: 1089676696

View in Genome Browser
Species Human (GRCh38)
Location 11:120095318-120095340
Sequence CTGCTGTCCTAGAGCAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089676691_1089676696 21 Left 1089676691 11:120095274-120095296 CCGAGGCTCAGAGGGGTGAGATG 0: 2
1: 0
2: 8
3: 97
4: 457
Right 1089676696 11:120095318-120095340 CTGCTGTCCTAGAGCAAGAGTGG No data
1089676694_1089676696 -7 Left 1089676694 11:120095302-120095324 CCCAAGGCACTGGTAGCTGCTGT No data
Right 1089676696 11:120095318-120095340 CTGCTGTCCTAGAGCAAGAGTGG No data
1089676695_1089676696 -8 Left 1089676695 11:120095303-120095325 CCAAGGCACTGGTAGCTGCTGTC No data
Right 1089676696 11:120095318-120095340 CTGCTGTCCTAGAGCAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089676696 Original CRISPR CTGCTGTCCTAGAGCAAGAG TGG Intergenic
No off target data available for this crispr