ID: 1089678678

View in Genome Browser
Species Human (GRCh38)
Location 11:120107499-120107521
Sequence GAGGCAAAGGAGTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089678678_1089678692 20 Left 1089678678 11:120107499-120107521 CCCCCTCCCCACTCCTTTGCCTC No data
Right 1089678692 11:120107542-120107564 AAGGTGATGAATTAGGAGCCAGG No data
1089678678_1089678693 26 Left 1089678678 11:120107499-120107521 CCCCCTCCCCACTCCTTTGCCTC No data
Right 1089678693 11:120107548-120107570 ATGAATTAGGAGCCAGGAGTTGG No data
1089678678_1089678688 1 Left 1089678678 11:120107499-120107521 CCCCCTCCCCACTCCTTTGCCTC No data
Right 1089678688 11:120107523-120107545 TCTTAGCCTCTGCCTTGGCAAGG No data
1089678678_1089678687 -4 Left 1089678678 11:120107499-120107521 CCCCCTCCCCACTCCTTTGCCTC No data
Right 1089678687 11:120107518-120107540 CCTCTTCTTAGCCTCTGCCTTGG No data
1089678678_1089678691 13 Left 1089678678 11:120107499-120107521 CCCCCTCCCCACTCCTTTGCCTC No data
Right 1089678691 11:120107535-120107557 CCTTGGCAAGGTGATGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089678678 Original CRISPR GAGGCAAAGGAGTGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr