ID: 1089679469

View in Genome Browser
Species Human (GRCh38)
Location 11:120111244-120111266
Sequence TCTGGGGACCCTCAGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 386}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089679460_1089679469 30 Left 1089679460 11:120111191-120111213 CCGTGCCTTCATCAGAGGGAAAA 0: 1
1: 0
2: 4
3: 27
4: 254
Right 1089679469 11:120111244-120111266 TCTGGGGACCCTCAGGGAAATGG 0: 1
1: 0
2: 2
3: 52
4: 386
1089679461_1089679469 25 Left 1089679461 11:120111196-120111218 CCTTCATCAGAGGGAAAAAGTGC 0: 1
1: 0
2: 2
3: 24
4: 205
Right 1089679469 11:120111244-120111266 TCTGGGGACCCTCAGGGAAATGG 0: 1
1: 0
2: 2
3: 52
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089679469 Original CRISPR TCTGGGGACCCTCAGGGAAA TGG Intergenic
900738514 1:4315770-4315792 TCTAGGGATCCTCATGGGAAGGG + Intergenic
900945788 1:5830726-5830748 CCTGGAGACCCTCAGGGGAGAGG - Intergenic
901884821 1:12215419-12215441 TGCTGGGAGCCTCAGGGAAAGGG - Intergenic
902368420 1:15991558-15991580 TCTGATGACCCTCATGGGAAGGG + Intergenic
902556513 1:17250099-17250121 TCTGGGGACCACCAGGGAGCTGG + Intronic
903014418 1:20352689-20352711 TCTGGGGCCCCTCAGGGCTTGGG + Intronic
903176089 1:21581778-21581800 TTTGGGGACTCTGGGGGAAAGGG - Intergenic
903349094 1:22707388-22707410 ACTGGGTACCCTCTGGGAATAGG - Intergenic
904396222 1:30224336-30224358 TCTGGAGAATCTCAGGGAAGTGG - Intergenic
905866452 1:41379590-41379612 TCTGGAGACCCTGAGGGGAGGGG - Intronic
907191294 1:52651168-52651190 TTTGGGGACCCTCAGGAAATTGG - Intronic
907212226 1:52833668-52833690 ACTAGGGCCACTCAGGGAAAGGG - Intergenic
907497578 1:54855014-54855036 ACTGGGGACCCTCAGGAACATGG - Intronic
907943718 1:59113217-59113239 TCAGAGGACCCTCAGGGAGCAGG - Intergenic
908460958 1:64348047-64348069 TATGGGGAAGCTCTGGGAAATGG - Intergenic
908773031 1:67613324-67613346 TCTGGGGCTCCTCAGAGAAGTGG - Intergenic
912237892 1:107872057-107872079 TCTGTGGATGGTCAGGGAAAAGG - Intronic
912452801 1:109777585-109777607 GCTGGGGACCCTGAGTGTAATGG - Intergenic
912842036 1:113047332-113047354 TCTGGGGAGGCCAAGGGAAAAGG + Intergenic
913133415 1:115863735-115863757 TCTCAGGACACTCAGTGAAAAGG + Intergenic
913534922 1:119762575-119762597 TCTGGGGACCCTCAGGTGGGAGG - Intronic
914913400 1:151803835-151803857 TCCGGGAACCCTCAGGAAGATGG + Intronic
915516470 1:156415708-156415730 CCTGGGGACCCTCTGGGTAAAGG - Intronic
915638538 1:157203518-157203540 TCTGAGGACCCTAGGGTAAAGGG + Intergenic
915651194 1:157312092-157312114 GCTGGTCACCCTCAGGGCAATGG + Intergenic
915660229 1:157399465-157399487 ACTGGTCACCCTCAGGGCAATGG - Intergenic
917153187 1:171966223-171966245 ACTGGGCACCATCAGGGCAAAGG - Intronic
917279504 1:173367738-173367760 TAGGAGGACACTCAGGGAAAAGG + Intergenic
920023544 1:202975048-202975070 TCTTGGAACTTTCAGGGAAAGGG - Intergenic
920401974 1:205681625-205681647 CCTGGGGACCCTCCTGGAGATGG + Intergenic
920960412 1:210658299-210658321 TCTGAGCACCCTCAGGGGCAGGG - Intronic
921735149 1:218618983-218619005 TCAGGAGACCTTGAGGGAAAAGG + Intergenic
921950625 1:220926437-220926459 GCTGGTGACCCTGAAGGAAATGG - Intergenic
922061117 1:222092954-222092976 TCAGGGGAGCCTCAGGAAAGAGG + Intergenic
922192894 1:223334877-223334899 TTTGGGGACCCAGGGGGAAAGGG - Intronic
923000912 1:230005689-230005711 TTTGGGGACTCTGGGGGAAAGGG - Intergenic
923275557 1:232392606-232392628 TCTGGGGACACTCAAGGGGAAGG + Intergenic
924829411 1:247577372-247577394 ACTGGTGAAACTCAGGGAAAAGG - Exonic
924917828 1:248592304-248592326 GCAGGGGATCCTCAGGGACAAGG - Intergenic
1063290254 10:4738311-4738333 TCTTAGGACACTCAGGGCAAAGG - Intergenic
1063735588 10:8749972-8749994 TTTGGGGACTCAGAGGGAAAGGG - Intergenic
1064048762 10:12042655-12042677 TCTGGGGTCCCCCAGGGAGTAGG + Intronic
1064429961 10:15262338-15262360 TCTGGGGGTCCTCACAGAAAAGG + Intronic
1064438440 10:15331638-15331660 GCTTTGGACCCTCAGGGATAAGG - Intronic
1066292186 10:34024603-34024625 TCTGGAGACCTTCATGGCAAAGG - Intergenic
1067617040 10:47764018-47764040 TCTGGGAGCCCTCAGGGCCAGGG + Intergenic
1070195259 10:74151053-74151075 TCTGGGGTCCCTCATGGTAGGGG + Exonic
1070393783 10:75993860-75993882 TCTGGAGACTGACAGGGAAAGGG - Intronic
1070582449 10:77732461-77732483 CCTGGGCACCCTGAGGCAAAAGG - Intergenic
1071392416 10:85189311-85189333 ACTAGGGCCACTCAGGGAAAGGG - Intergenic
1071404976 10:85320793-85320815 TTTGGTGACTTTCAGGGAAAGGG + Intergenic
1073002114 10:100293516-100293538 TCTGGGGACCCTGAGAGGCAGGG - Intronic
1074944622 10:118269523-118269545 TCTTGGAACCCTCAGGGGGAAGG - Intergenic
1075241216 10:120780746-120780768 CCTTAGGAGCCTCAGGGAAAGGG + Intergenic
1075737274 10:124671628-124671650 TCTGTGGCCCTTCAGGGAGAGGG + Intronic
1075784413 10:125039185-125039207 TCTGGAGACCCTCTGGGCACAGG + Intronic
1076624573 10:131813671-131813693 TCTAGGGACCCACATGAAAAGGG - Intergenic
1077859125 11:6159641-6159663 ACTAGGGCCACTCAGGGAAAGGG - Intergenic
1077873767 11:6285116-6285138 ACTAGGGACGCTCAGGGAAAGGG + Intergenic
1078329927 11:10410793-10410815 TCTGGAGTCCCTGGGGGAAAGGG + Intronic
1080648342 11:34203518-34203540 TGTGGGGCCCCTCAGGGGACAGG + Intronic
1080652930 11:34236860-34236882 TCTGGGAACCCTCAGGGATTCGG + Intronic
1081375329 11:42351570-42351592 TCTGTGAACCATCATGGAAAGGG + Intergenic
1081604242 11:44517434-44517456 TCTGGTGACTCTCAGAGAAGTGG - Intergenic
1081702624 11:45161624-45161646 TCCCGGGACTCTCAGGGGAAAGG - Intronic
1083744411 11:64727221-64727243 GCTGGGGAGTATCAGGGAAATGG - Intronic
1084967309 11:72751496-72751518 TCTGGGGACTCTCCGCGAACAGG + Intronic
1085094559 11:73749346-73749368 TTTGGGGACTCACAGGGAAGTGG + Intronic
1085201686 11:74705841-74705863 TCTGGGGAATCTCTGGGAAGGGG + Intronic
1085316022 11:75545338-75545360 CCTGGGGACCCTCTGAGACATGG - Intergenic
1085400047 11:76230469-76230491 TCTGGGGACCCCCAGAGAGCAGG - Intergenic
1087577645 11:100009992-100010014 TCTAGGGACCTTAATGGAAATGG + Intronic
1087649214 11:100845334-100845356 TTTGGGGACTCAGAGGGAAAGGG + Intronic
1088034529 11:105296038-105296060 GCTGGGGATACCCAGGGAAAGGG - Intergenic
1088793736 11:113249477-113249499 ACTGGTGACCCTAAGGGAACTGG - Intronic
1088988302 11:114929138-114929160 TCTGGGGGTCCTGGGGGAAAGGG + Intergenic
1089144242 11:116312872-116312894 TGTGGGGGCCCTCAGGATAATGG + Intergenic
1089168126 11:116493390-116493412 TCTGGCTGCCCTCAGAGAAAAGG + Intergenic
1089523099 11:119078712-119078734 TTTGGGGAATTTCAGGGAAAGGG + Intronic
1089679469 11:120111244-120111266 TCTGGGGACCCTCAGGGAAATGG + Intergenic
1090206018 11:124884867-124884889 TCTGGGAAGTCTCAGGGACACGG + Exonic
1092384677 12:8026997-8027019 TCTGGAGGACCTCAGGGATAAGG - Intergenic
1095099993 12:38170773-38170795 TTTGGGGACTCACGGGGAAAGGG - Intergenic
1096337148 12:50764760-50764782 GCTGGCGACCCTGAGGGAAGAGG + Intronic
1096468723 12:51863529-51863551 TCCGTGGACCCGCTGGGAAAGGG + Intergenic
1096587936 12:52635789-52635811 TTTGGGGACCCAGGGGGAAAGGG + Intergenic
1097083340 12:56449309-56449331 TCTGAGGACCCGCAGGGAGCGGG - Exonic
1097200333 12:57272856-57272878 TCTGAGGACTCTCAGGGTCAGGG + Intronic
1097241222 12:57576546-57576568 TCCTGGGACCCTCAAGGATAGGG - Intronic
1097244636 12:57600708-57600730 TCTGGGGCCCTTCTGGGGAAAGG - Intronic
1097254132 12:57659352-57659374 ACTGGGGCCACTCAGGGAAAAGG + Intergenic
1097995212 12:65881254-65881276 TCTGGAGACCCTCAGAGACAAGG - Intronic
1099535081 12:83833450-83833472 TCTTGGGACCTTAAGAGAAAAGG - Intergenic
1100070526 12:90710833-90710855 ACTGGGAAACTTCAGGGAAATGG + Intergenic
1100458110 12:94772327-94772349 TCAGGGAGCCCTCAGGGAATAGG + Intergenic
1100788314 12:98102409-98102431 TTTGGGGACTCTGTGGGAAATGG + Intergenic
1100850884 12:98709803-98709825 TCAGGGAATCCTCAGGGCAAGGG - Intronic
1101826812 12:108226854-108226876 TTTGGGGACCCTCAAGTTAAGGG + Intronic
1102648011 12:114416125-114416147 TCTGTGAACCCTCGGGGACAAGG - Intergenic
1102820748 12:115907336-115907358 TCTGGGGACTCAGAAGGAAAGGG + Intergenic
1104210896 12:126687620-126687642 TCTGGGGACTCAGAGGGAAAGGG + Intergenic
1104524603 12:129507692-129507714 TCTGGGGACTCAAGGGGAAAGGG + Intronic
1106136094 13:26974867-26974889 TTTGGGGACTCAGAGGGAAAAGG - Intergenic
1106284683 13:28308406-28308428 TCTGTAGAACCTCAGGGGAAAGG + Intronic
1106796934 13:33216548-33216570 TTTGGGGACTCTGGGGGAAAGGG + Intronic
1108590293 13:51906843-51906865 GCTGGGGACCAACAGTGAAAGGG + Intergenic
1110206511 13:72920676-72920698 TCTGGGGAGCCTGAGGCAGAAGG + Intronic
1110891830 13:80705575-80705597 TCTTGGGACCCTCATTGCAAGGG + Intergenic
1111162228 13:84410172-84410194 TCTGGGGACTCAGAAGGAAAGGG + Intergenic
1115648319 14:35385265-35385287 ACTGTGGAACCTCAGGAAAAAGG + Intergenic
1117511035 14:56451002-56451024 GCTGGGGAGACTGAGGGAAAGGG + Intergenic
1118794632 14:69130043-69130065 GCTCGGGACCCTTTGGGAAAGGG - Intronic
1119474128 14:74917418-74917440 TCTGGGGGCCCACAGAGAAAAGG - Intronic
1119744005 14:77031661-77031683 TCTGGGGCCCCTGAGTGCAAAGG + Intergenic
1120868122 14:89312926-89312948 TCTTGAGACCTTCAGCGAAAAGG - Intronic
1121095760 14:91217050-91217072 TCTGGGGCTCCTCAAGGAGATGG + Intronic
1121105939 14:91279801-91279823 TCAGGGGACCCACAGGGAGCAGG + Intronic
1121117194 14:91352061-91352083 GCAGGGGACGCTCTGGGAAAGGG + Intronic
1123709763 15:22979243-22979265 GCTGGCCACCCGCAGGGAAAAGG + Intronic
1125540130 15:40465465-40465487 CCTGGGGAGCCTGAGGGAAGAGG - Intronic
1125863616 15:43021422-43021444 TCTTGGTATCCTCAGGGAATTGG + Intronic
1127195169 15:56576447-56576469 TCTGGGGACTCAGGGGGAAAGGG + Intergenic
1127854572 15:62943746-62943768 TCTGGGCAGCCTCATGGAGAAGG - Intergenic
1127959987 15:63883702-63883724 TCTGAAGACCCTCGGGGATAAGG - Intergenic
1128088632 15:64903991-64904013 TCTGGGAACCCTCAGGAAAGGGG + Intronic
1128250370 15:66159729-66159751 TCTGGGGACCTTTTGGGGAAGGG + Intronic
1128313529 15:66646268-66646290 TTTGGGGACCCTCTGAGGAATGG - Intronic
1128664722 15:69529786-69529808 TCAGGGGACCGACAGGGAGAAGG - Intergenic
1129268366 15:74406895-74406917 TCTGGGGTCCCTGGGGGAGAAGG - Intergenic
1129556063 15:76511086-76511108 TCTGGGGACTCAGGGGGAAAGGG + Intronic
1129988832 15:79943870-79943892 TTTGGGTACCTACAGGGAAAGGG + Intergenic
1130835458 15:87645718-87645740 CTTGGGGACCCTCAGTGTAAAGG - Intergenic
1131474214 15:92722491-92722513 TTTGGGGACTCAGAGGGAAAGGG - Intronic
1132038990 15:98508910-98508932 TCTGGGAACACTCTGAGAAAAGG - Intronic
1132550168 16:550926-550948 ACAGGGGACCCTCACCGAAAGGG - Intronic
1133328892 16:4959000-4959022 TCTGGGGGCCCTCAGTGTGAAGG + Intronic
1134413315 16:14021580-14021602 TTTGGGGACTCAGAGGGAAAGGG - Intergenic
1135244948 16:20847556-20847578 TCTGAGGACCATTAGGGAGATGG + Intronic
1135398564 16:22149623-22149645 CCTGTGGCCCCTCAGGGAGAGGG - Intronic
1135680073 16:24448770-24448792 TCTAGGGGCCCTCAGGAAAAAGG - Intergenic
1136025040 16:27463583-27463605 TCTGTGAACCCTGAGGGAAGAGG + Exonic
1136542819 16:30937808-30937830 TGTGGGTGCCCCCAGGGAAAGGG + Intronic
1137712134 16:50573803-50573825 TCTGAGAACTCTCACGGAAACGG + Intronic
1137935168 16:52628167-52628189 TCTGGGGACTCAGAGGGGAAGGG + Intergenic
1138199372 16:55077686-55077708 TCAGGGGACTCTCAGGGAGCAGG + Intergenic
1139365972 16:66433865-66433887 TCTGGGGATCCTCATGGCAGAGG - Intronic
1139924954 16:70480948-70480970 GCTGGGGCCCCTTAGGGAACAGG + Exonic
1140116951 16:72050395-72050417 TCTGTGGGTCCTCAGGGAAGTGG - Intronic
1140942651 16:79736297-79736319 TTTGGGGACCACCTGGGAAAGGG - Intergenic
1141260269 16:82447061-82447083 CTTGGGGACCCAGAGGGAAAGGG + Intergenic
1141263437 16:82474471-82474493 TGACGGGATCCTCAGGGAAAGGG + Intergenic
1142376011 16:89707491-89707513 CCTGGGGAGCATCAGGGAAGAGG - Exonic
1142467035 17:141951-141973 TCCGGGGTCTCTCGGGGAAACGG - Intergenic
1142815121 17:2419387-2419409 TCTGGGGACCACCCGGTAAATGG - Exonic
1143408186 17:6691876-6691898 TCTTGGGGCCCTCAGAGAAGTGG + Intronic
1143512294 17:7403582-7403604 TCTGGGGTCCCTGGGGGAAGTGG - Intronic
1143651477 17:8266449-8266471 TCAGGGAAGACTCAGGGAAAGGG - Intronic
1143671345 17:8398040-8398062 CCTGGGGAGCCTCAGTCAAAGGG - Intergenic
1143771893 17:9174212-9174234 TTTGGGGACCCTCAGAGACATGG + Intronic
1144827787 17:18116118-18116140 GCTCAGGACCCTTAGGGAAAGGG + Intronic
1144867180 17:18344007-18344029 TCTGAGAAGCCTCAGGGAAGAGG + Intronic
1144952922 17:19003788-19003810 TCTGAGGACCCTCGGGGCACGGG - Exonic
1145216630 17:21057414-21057436 TCAGGTGGCCTTCAGGGAAATGG + Intergenic
1145996018 17:29105488-29105510 TCTGGGGAGACCCAAGGAAATGG + Intronic
1146034217 17:29391224-29391246 TCCGGTGACCCTCAGGAAAAAGG - Intronic
1147121377 17:38337274-38337296 TGTGGTGACTATCAGGGAAAAGG - Intronic
1147455694 17:40536783-40536805 GCTGGAGAGCCTCAGGGAGAAGG - Intergenic
1147783561 17:42961442-42961464 TCTGGGCTCCCTAAGGGAGAGGG + Intronic
1147886530 17:43688011-43688033 TGGGGTGACCCTCAGGGTAAGGG + Intergenic
1149105232 17:52955473-52955495 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
1149366534 17:55951091-55951113 TTTGGGGACTCAGAGGGAAAGGG - Intergenic
1149685263 17:58531406-58531428 TCTGGGGTCCCTTTGGGAAAGGG + Intronic
1151366905 17:73623489-73623511 TCTGGGGGCCTTCAGGGGGAAGG - Intronic
1151479580 17:74362186-74362208 ACTGGGGACCCTCAGGCCAATGG - Intergenic
1152314655 17:79573134-79573156 TCTGGGAATCTTCAGGGAGAGGG - Intergenic
1152423355 17:80205631-80205653 TGTGGAGTCCCTCATGGAAAAGG + Exonic
1152809709 17:82375667-82375689 CCTGGAGACCCTCAGGGAGGCGG - Intergenic
1155361751 18:25010136-25010158 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
1157124415 18:44942467-44942489 TTTGGGGCTCCTGAGGGAAATGG - Intronic
1157154385 18:45251183-45251205 TTTGGGGACTCAGAGGGAAAGGG - Intronic
1157661756 18:49451513-49451535 TCTTGGGACCTTAAGAGAAAAGG + Intronic
1157699141 18:49749098-49749120 TTTGGGGAAACTCAGGTAAAGGG - Intergenic
1157855046 18:51097851-51097873 CTTCTGGACCCTCAGGGAAAGGG + Intergenic
1158398461 18:57098353-57098375 TTTGGGGACTCTAGGGGAAAGGG + Intergenic
1158608794 18:58919871-58919893 CCTGGGCACCCTGAGGCAAAAGG - Exonic
1160317076 18:77858432-77858454 CCTGGGGACCCTCTGGGATGGGG + Intergenic
1160875434 19:1294420-1294442 TCTGGGGGACCTCAGGGCAAAGG + Intronic
1160951262 19:1668766-1668788 TCTGGGGAACCACAGGGCAGAGG + Intergenic
1163311090 19:16514970-16514992 TCTCAGGAGGCTCAGGGAAAGGG - Intronic
1163782350 19:19257190-19257212 GCAGGGGACTCTCAGGGAGAGGG + Exonic
1163790468 19:19303189-19303211 TCTGGGGTCACTCTGGGAATGGG - Intronic
1163804427 19:19386987-19387009 GCAGGGGTCCCTCAGAGAAAGGG - Intronic
1164146052 19:22513227-22513249 GCTGGGGAGCCTCGGGGAAGGGG - Intronic
1164470207 19:28523540-28523562 ACTAGGGGCGCTCAGGGAAAGGG + Intergenic
1164551581 19:29216816-29216838 TCTGGAGACTCTAAGGGAGAAGG - Intergenic
1164850148 19:31475534-31475556 TTTGGGGACTCACGGGGAAAGGG - Intergenic
1165204749 19:34173519-34173541 TCTGGAGGCTCTCTGGGAAAGGG + Intronic
1165266437 19:34666167-34666189 TGTGGGGACCCTGTGGGACAGGG - Intronic
1166259605 19:41628187-41628209 CCTGGGGACCCACAGTGAACAGG - Intronic
1166407229 19:42529584-42529606 CCTGGGGACCCGCAGTGAACAGG - Intronic
1166713448 19:44951589-44951611 TCTGGGGGCCCTGAGGGGAATGG - Intronic
1167658313 19:50780674-50780696 TCTGGGGACCCACAGAGGACAGG + Intergenic
1167787407 19:51647137-51647159 CCTCGGGACCCTCAGCGAGATGG + Intergenic
1168121846 19:54256142-54256164 TCACGGGACCCACAGGGAACAGG + Exonic
1168294555 19:55372531-55372553 TCTGGGGGCTCTCGGGGACATGG - Intergenic
925338439 2:3115646-3115668 TTAGTGGCCCCTCAGGGAAAAGG + Intergenic
925471777 2:4170135-4170157 TCTTGGGACCTTAAGAGAAAAGG - Intergenic
925660845 2:6200530-6200552 TATGGAGACACTCAGGGAGATGG - Intergenic
925677453 2:6379213-6379235 TTTGGGGACTCCAAGGGAAAGGG + Intergenic
926245774 2:11121663-11121685 TCTTCGGAAGCTCAGGGAAAAGG - Intergenic
927847060 2:26477104-26477126 TCTGGGGCCCCTCAGGATCAGGG - Intronic
927911631 2:26903933-26903955 TCTCTGGACCCTCACGGAAGAGG - Intronic
932965825 2:76473563-76473585 ACTAGGGCCGCTCAGGGAAAGGG + Intergenic
935148206 2:100410572-100410594 CCTGGAGACCCTCAGGGAGAGGG - Intronic
936038504 2:109130437-109130459 TCTGGGGACCCAGAGGAAGAAGG - Intronic
937693069 2:124778264-124778286 TCTGGGCAGACTCAGAGAAATGG - Intronic
940236213 2:151513350-151513372 TCTGGGGACATTCAGAGCAAAGG - Intronic
940802749 2:158151371-158151393 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
941680125 2:168389081-168389103 TCTGGGGACTCAGGGGGAAAGGG + Intergenic
942246527 2:174013293-174013315 CCCGGCGACCCTCAGGGAAGGGG + Intergenic
943431866 2:187812966-187812988 TTTGGGGACCTAGAGGGAAAGGG + Intergenic
945704563 2:213213372-213213394 ACTGGGGCCGCTCGGGGAAAGGG - Intergenic
948065102 2:235072464-235072486 TCTGGGGACTCAGGGGGAAAGGG + Intergenic
948842278 2:240658325-240658347 TTTGGGGACTCAGAGGGAAAGGG - Intergenic
1169305899 20:4490154-4490176 TCTGGGGAACCAGAGGGAAAAGG + Intergenic
1169422783 20:5473252-5473274 TCTGGGGACCCTCATGGGAAGGG + Intergenic
1169426642 20:5502223-5502245 TCTGGGGACCCTCATGTGAAGGG - Intergenic
1173752204 20:45486378-45486400 GCTAGGGCCACTCAGGGAAAGGG - Intergenic
1173849176 20:46207168-46207190 TCTGAGGAGCCCCAGGGAAGGGG + Intronic
1174340184 20:49890642-49890664 TGTGGGGTCTCGCAGGGAAAAGG + Exonic
1175093726 20:56525098-56525120 TCTCAGGAGTCTCAGGGAAACGG + Intronic
1175094918 20:56533631-56533653 TCTCAGGAGTCTCAGGGAAACGG + Intronic
1175333337 20:58179340-58179362 TCCCGGGACCATCAGGTAAAAGG - Intergenic
1175404216 20:58716453-58716475 TCTGAGGCCCCACAGGGAAGGGG + Intronic
1176625588 21:9088472-9088494 TCTGGGCACCCTCAGAGCAGCGG + Intergenic
1177849478 21:26329538-26329560 TATGAGGACACACAGGGAAAAGG - Intergenic
1178721204 21:35011212-35011234 TCTTGGGACAAACAGGGAAAGGG + Intronic
1179419695 21:41225601-41225623 TCTGGGGACCAGAAGGGAAAGGG + Intronic
1179711841 21:43268045-43268067 TCTGAGGTCCCTCAGGGAGCAGG - Intergenic
1180656830 22:17428848-17428870 TCTGGGAATGCTCAGGGAATAGG + Intronic
1180817790 22:18803129-18803151 TCAGGGGACCCTGAGTGAAATGG - Intergenic
1181204006 22:21237582-21237604 TCAGGGCACCCTGAGTGAAATGG - Intergenic
1181345898 22:22220535-22220557 TCTGGACACCCTAAGGGAGATGG + Intergenic
1183050330 22:35255732-35255754 TCTGGGGAAACACATGGAAATGG + Intergenic
1183268192 22:36843973-36843995 TCTGGGGACTCCCAAAGAAATGG - Intergenic
1183302492 22:37065214-37065236 TTTGGGGACCCTCAGGTCAGAGG - Intergenic
1184160737 22:42695758-42695780 TCAGGGGACACTCAGGGAATAGG + Intronic
1184246449 22:43238093-43238115 TGAGGGGACCCTCAGGAAACAGG - Intronic
1184391675 22:44206792-44206814 GCTGGGGACTCTCAGGGACAGGG + Exonic
1184780358 22:46646005-46646027 TCTGAGGACCCTCGGGGCCAGGG + Intronic
1185385236 22:50528871-50528893 TCTGGGGACCCAAGGGGAAAGGG + Intronic
1203222915 22_KI270731v1_random:57833-57855 TCAGGGCACCCTGAGTGAAATGG + Intergenic
1203267914 22_KI270734v1_random:28980-29002 TCAGGGCACCCTGAGTGAAATGG - Intergenic
949946024 3:9190849-9190871 GCTGGGGACCCTTAGGGGAGGGG + Intronic
950605805 3:14079116-14079138 ACTGGGGCTGCTCAGGGAAAAGG - Intronic
950666940 3:14503419-14503441 CCTGGGCACCCTGTGGGAAAAGG - Intronic
951861101 3:27253702-27253724 TCTGGGGACCCTGCAGGGAAGGG + Intronic
951948802 3:28174644-28174666 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
952023475 3:29051425-29051447 ACTAGGGTCGCTCAGGGAAAGGG - Intergenic
952126834 3:30310605-30310627 CATGGGGACACTCAGTGAAAAGG + Intergenic
953140886 3:40228193-40228215 TCTGGAGCCCCTCTGTGAAAAGG - Intronic
953536768 3:43782765-43782787 CCTGGGCACCCCCAGGGATAAGG + Intergenic
953572249 3:44080217-44080239 TCTGAGCACCCTGAGGCAAAGGG + Intergenic
953776548 3:45822401-45822423 GCTGGGGACCCTCTGAGACATGG - Intergenic
954432793 3:50480221-50480243 TTTGGGAAGCCTCAGGGGAAAGG + Intronic
957003938 3:74921302-74921324 TTGGGGGAGCTTCAGGGAAAAGG + Intergenic
957003964 3:74921564-74921586 TTGGGGGAGCTTCAGGGAAAAGG + Intergenic
957539307 3:81547533-81547555 ACTGGGGCCACTCAGGGCAAGGG + Intronic
958161976 3:89829053-89829075 TCTGGGAACTGTCTGGGAAAGGG - Intergenic
959567920 3:107851690-107851712 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
960007123 3:112791539-112791561 TCGGGTCACCCTCAGGGAAGGGG + Intronic
960884427 3:122380220-122380242 TCTGGGTACCATCAGGCAAAGGG - Intronic
961158478 3:124701021-124701043 TCTGGGAAACCTGAGGGAACTGG + Intronic
961477963 3:127160411-127160433 TCTTGTGACTCTCAGGGTAATGG - Intergenic
961494759 3:127283567-127283589 TCTGTGGATCCTCAGGACAATGG + Intergenic
962202215 3:133410538-133410560 CCTGGGGACCCTAATGCAAACGG + Intronic
962765407 3:138557644-138557666 TTTGGGGACTCAGAGGGAAAGGG + Intronic
963005993 3:140726661-140726683 TCTGAGGACCCTGAGGGACCTGG + Intergenic
963676509 3:148317972-148317994 TCTTGGGAACCTCACAGAAATGG + Intergenic
964377232 3:156060302-156060324 TCTGGCTACACTCAGGGAATAGG + Intronic
965149536 3:164951988-164952010 ACTAGGGCCGCTCAGGGAAAGGG + Intergenic
966774661 3:183533380-183533402 ACTGGGGAGCCTGAGGGAAGAGG - Intronic
966827642 3:183978479-183978501 TCAGGGAACCCTCAGGGATGGGG - Intronic
968901944 4:3436098-3436120 GCTGGGGACCCACACGGACAGGG + Intronic
969529634 4:7723545-7723567 TCTGGGGACCCACAGGAGACCGG - Intronic
969706022 4:8792013-8792035 TCCGGGGTTCTTCAGGGAAATGG + Intergenic
969726329 4:8920476-8920498 TCTGGGGATTCTTAGGGGAAGGG + Intergenic
970328233 4:14951293-14951315 TTTGGGGACTCACAGGGAAAGGG + Intergenic
972935329 4:44127760-44127782 TCTGGGGTCTGTCTGGGAAAAGG + Intergenic
973925170 4:55729720-55729742 TCTGGGAAATCTCAGGCAAAAGG + Intergenic
974051838 4:56949154-56949176 ACTAGGGCCACTCAGGGAAAGGG - Intergenic
975410469 4:74043032-74043054 ACTGGGGACCCTCTGAGAAATGG - Intergenic
975872112 4:78791239-78791261 TATGTGGACCCCAAGGGAAAGGG + Intronic
976738319 4:88333175-88333197 TTTGGGGACTCGGAGGGAAAGGG + Intergenic
977552350 4:98455885-98455907 TTTGGGGACTCGGAGGGAAAAGG + Intergenic
977999282 4:103537241-103537263 ACCGGGTACCCTCAGAGAAATGG - Intergenic
978019690 4:103792271-103792293 TCTTGGGACCTTAAGAGAAAAGG + Intergenic
978426064 4:108583884-108583906 TTTGGGGACTTTCGGGGAAAGGG + Intergenic
979773602 4:124559685-124559707 ACTAGGGCCGCTCAGGGAAAGGG + Intergenic
980238310 4:130137425-130137447 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
981162355 4:141513777-141513799 TGTGGGAAGCCTCAGGGAAATGG + Intergenic
982455185 4:155601401-155601423 TTTGGGGACTCTGTGGGAAAGGG - Intergenic
984650402 4:182263999-182264021 ACTAGGGCCGCTCAGGGAAAGGG + Intronic
985672776 5:1214788-1214810 ACAGGGGACCCTCAGTGCAAGGG + Intronic
985674327 5:1223016-1223038 TCTGGGAACCCCCAGGTCAAAGG - Exonic
986275234 5:6268999-6269021 TGTGTAGACCCTCAGGGATATGG - Intergenic
986685410 5:10271817-10271839 TCTGGGGAGCCTCAGCGGATGGG - Intergenic
988700812 5:33672824-33672846 CCTGAGGCCCTTCAGGGAAATGG - Intronic
988784755 5:34556209-34556231 TCTGGGTTCCCTAAGGGCAAGGG + Intergenic
989337085 5:40330719-40330741 ACTAGGGCCGCTCAGGGAAAGGG - Intergenic
991230097 5:64322825-64322847 TTTGGGGACCCAGGGGGAAAGGG + Intronic
992198539 5:74362942-74362964 TCAGGGGACCCTGAGTGACAGGG - Intergenic
992223361 5:74594431-74594453 TGTGGGGACTCTGAGGGCAAAGG - Intergenic
992889235 5:81188766-81188788 TCGGTGGAACCTCAGGGAAATGG - Intronic
993733433 5:91448447-91448469 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
994322490 5:98409290-98409312 TGTGGTGACACTTAGGGAAAAGG - Intergenic
994363597 5:98884493-98884515 TCTGGGGACTCAGAGGGAAAGGG + Intronic
994833929 5:104823850-104823872 TCTGGGGACTCAGGGGGAAAGGG - Intergenic
995240889 5:109884641-109884663 GCTCAGGACCCTCAGGGACACGG - Exonic
996291137 5:121853168-121853190 TCTTGGGACACACTGGGAAAAGG - Intergenic
996928261 5:128855216-128855238 TCTGGGTCCAGTCAGGGAAATGG + Intronic
997649313 5:135503851-135503873 ACTGGGGACCCTCTTGGAAAGGG - Intergenic
998402154 5:141853588-141853610 TCTGGGAGCTCCCAGGGAAAGGG + Exonic
999906128 5:156143080-156143102 CCTGAGGTCGCTCAGGGAAATGG - Intronic
1000511133 5:162184632-162184654 TTTGGGGACTCACGGGGAAAGGG - Intergenic
1000584049 5:163073588-163073610 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
1000914313 5:167061540-167061562 GTTTGGGACACTCAGGGAAATGG + Intergenic
1001340270 5:170837096-170837118 TCTGGGAGCCCCCAGGGAAATGG + Intergenic
1002209186 5:177585855-177585877 TCTGGGGACTCAGGGGGAAAGGG - Intergenic
1002258512 5:177977966-177977988 TCTAGCGGCCATCAGGGAAAGGG + Intergenic
1002370865 5:178753106-178753128 TCTGGGAGCCCCTAGGGAAATGG - Intergenic
1002456952 5:179350703-179350725 TCTTGGAACCCTCAGAGGAAGGG - Intergenic
1002501355 5:179649580-179649602 TCTAGCGGCCATCAGGGAAAGGG - Intergenic
1005359862 6:25021623-25021645 TCTGGGGATTCAGAGGGAAAGGG + Intronic
1005496443 6:26392240-26392262 TCAGGGGACCTTCATGGAAACGG + Intronic
1006118761 6:31791534-31791556 TCGGGGGGCTGTCAGGGAAAAGG + Intronic
1006520431 6:34568199-34568221 TCTGGGAGCCCACAGGGACAGGG + Intergenic
1006819373 6:36879428-36879450 ACTGGGGCCGCTGAGGGAAAGGG + Intronic
1007112432 6:39320651-39320673 GCTGAGGACTCTCAGGGAAAGGG + Intronic
1007902360 6:45423273-45423295 TTTGGGGATCCTGGGGGAAAGGG - Intronic
1010719224 6:79263555-79263577 GCTAGGGCCCCTGAGGGAAAGGG - Intergenic
1011205625 6:84892968-84892990 TCTGGGGACTATCTGGGAACAGG + Intergenic
1011319493 6:86074963-86074985 TTTGGGGACCCAGGGGGAAAGGG - Intergenic
1014954773 6:127601073-127601095 TCTTGGGACCTTAAGGGAAGAGG - Intergenic
1015222672 6:130822589-130822611 TTTGGGGACTCACGGGGAAAGGG + Intergenic
1016312933 6:142753826-142753848 CATTAGGACCCTCAGGGAAAAGG + Exonic
1017404841 6:154108087-154108109 ACTAGGGCCGCTCAGGGAAAGGG - Intronic
1019337322 7:491589-491611 TCTGAGTACCCTCAGGGAGTGGG + Intergenic
1021985190 7:26091212-26091234 TCTGGGGACAATCGGAGAAAGGG - Intergenic
1022443026 7:30449236-30449258 GCTGGGGACTCTGAGGGAAAGGG - Intronic
1022990190 7:35699113-35699135 TTTGGGGACTTTCAGGGAAAGGG + Intergenic
1024988302 7:55214428-55214450 TCTGCCCACCCCCAGGGAAAGGG + Intronic
1025018372 7:55461219-55461241 TTTGGGGACTCACGGGGAAAGGG + Intronic
1025768701 7:64483178-64483200 ACTGGGGCCACTCAGGGTAAAGG + Intergenic
1025865541 7:65377411-65377433 GCTGGGGACCCACAGGCAGATGG + Intronic
1026069619 7:67106558-67106580 TCTGAGGAACCTCAGAGAACTGG + Intronic
1026707288 7:72705764-72705786 TCTGAGGAACCTCAGAGAACTGG - Intronic
1027269344 7:76511528-76511550 TCTGGGGGCCCTGAGGGAGGAGG + Intronic
1027320055 7:77005423-77005445 TCTGGGGGCCCTGAGGGAGGAGG + Intergenic
1027724841 7:81791037-81791059 TCTGGGAATCTTCAGGGAAGAGG - Intergenic
1027788978 7:82615576-82615598 TGGGGGGACCCTCAGGAAACTGG + Intergenic
1028529171 7:91819148-91819170 TTTGGGGACTCTGGGGGAAAAGG - Intronic
1028975513 7:96908813-96908835 TCTGGGGACCAGTAGGCAAAGGG - Intergenic
1029603372 7:101583184-101583206 GCTGGGGTCCCTCAGGGATGAGG + Intergenic
1029686039 7:102148848-102148870 TCTGGGGACTTGCGGGGAAAGGG - Intronic
1030189858 7:106800217-106800239 ACTAGGGCCACTCAGGGAAAGGG - Intergenic
1031186519 7:118487762-118487784 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
1031304983 7:120114847-120114869 ACTGAGGTCACTCAGGGAAAGGG + Intergenic
1032449331 7:132016079-132016101 TTTGGGGACTCAGAGGGAAATGG + Intergenic
1033337431 7:140465509-140465531 TCTGGACACCCTCTGGGGAAAGG - Intronic
1034470712 7:151253019-151253041 TCTGAGGACACTGAGGGACAGGG - Intronic
1034682710 7:152941457-152941479 TTTGGGGACTCAGAGGGAAAGGG - Intergenic
1035928829 8:3759026-3759048 TCTGGAGACTCTATGGGAAAAGG - Intronic
1037687567 8:21156427-21156449 TTTGGGGACTTGCAGGGAAAGGG + Intergenic
1037810606 8:22084444-22084466 TCTGGGGACTCAGGGGGAAAGGG + Intergenic
1037829770 8:22180512-22180534 TATGGGGACCCGCAGGGGAGGGG - Intronic
1038815813 8:30902950-30902972 TCTGTTGCCCCTCAGGGAAAAGG + Intergenic
1039286470 8:36046863-36046885 TCTGGTGACCCTCTGAGAAAAGG - Intergenic
1039382748 8:37101201-37101223 ACTTGGGAGCCCCAGGGAAAAGG + Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1040526721 8:48232105-48232127 TCTTGGGACCTTAAGAGAAAAGG + Intergenic
1041713205 8:60911351-60911373 TTTGGGGACCCTTGGGCAAAAGG + Intergenic
1042280586 8:67052175-67052197 CCTGAGAAGCCTCAGGGAAAAGG + Intronic
1044907732 8:97023309-97023331 TTTGGGGACTCAGAGGGAAAGGG + Intronic
1045019291 8:98027734-98027756 TCTGGGCACCCTTGTGGAAAGGG - Exonic
1046646486 8:116791486-116791508 TTTGGGGACTCTGGGGGAAAGGG - Intronic
1047753210 8:127898465-127898487 TCAGGGAACCTTCAGGGAAAAGG + Intergenic
1049444825 8:142625043-142625065 TCTGGGGATCCTCAGGGTGGAGG + Intergenic
1049606051 8:143529702-143529724 GCTGGGGTCCCTCAGGCACACGG - Intronic
1049672514 8:143876260-143876282 AGAGGGGACCCTCAGGGAAGAGG + Intronic
1049735126 8:144200807-144200829 TCTGGGAACCCTCAGAGGCATGG - Intronic
1050612376 9:7366494-7366516 ACTGAGGACCCTCAGGAAAAGGG + Intergenic
1050663455 9:7909006-7909028 TTTGGGGACTCTTGGGGAAAGGG + Intergenic
1050690796 9:8224262-8224284 TCTGGAGGGCCTCATGGAAATGG - Intergenic
1051147525 9:14043290-14043312 TCTGATGACCTCCAGGGAAAAGG + Intergenic
1052383518 9:27797896-27797918 TCTGGGAAGCCTTAGGGAAGGGG + Intergenic
1052389805 9:27866461-27866483 TATGGGGACCCAAAAGGAAATGG + Intergenic
1052521044 9:29548621-29548643 ACTAGGGCCGCTCAGGGAAAGGG + Intergenic
1052980933 9:34448830-34448852 TCTGGGGACTCACAGGGGAAGGG + Intronic
1053024277 9:34717482-34717504 ATTGGGGGCCCTCAGGGAGATGG + Intergenic
1053737133 9:41108701-41108723 TCTTGGGACCCCCATGGGAAGGG + Intergenic
1056806961 9:89736462-89736484 TCTGCCTGCCCTCAGGGAAAGGG + Intergenic
1056986922 9:91371900-91371922 TTTGGGGAGGCTCAGGGATATGG - Intergenic
1057218846 9:93244818-93244840 TCTAGGGAGCCTCAGAGAACGGG - Intronic
1057552691 9:96063592-96063614 ACTTGGGACCCTCTGGGAAATGG - Intergenic
1057887241 9:98839114-98839136 TCTGGGAACCCTCAGGAAAAGGG - Intronic
1058239686 9:102541349-102541371 TATGGGGACCCACTGTGAAATGG - Intergenic
1058645957 9:107131561-107131583 CCTGGGGACTTTCAGGGACAAGG + Intergenic
1059838070 9:118179622-118179644 TCTGGGGAGTCTGAGGGAGAAGG - Intergenic
1060681487 9:125568797-125568819 ACTGGGGCCGCTCAGGGAAAGGG + Intronic
1060961859 9:127686443-127686465 TCTGGTGATCCTCAGGGGAATGG + Intronic
1061394092 9:130333819-130333841 TCTGCGGAGACTCAGGGAAAAGG - Intronic
1061547427 9:131312927-131312949 GCTGGGCAACCTTAGGGAAATGG - Intergenic
1061882023 9:133573413-133573435 CCAGAGGACCCTCAGGGAGATGG + Intronic
1061901428 9:133674171-133674193 AGTGGGGACCCACAAGGAAAGGG + Intronic
1061907113 9:133704431-133704453 TCTGGGGACTCCCAGGGACCTGG - Intronic
1062107811 9:134765414-134765436 ACAGGGCACCCTCAGGGAAAGGG - Intronic
1062494028 9:136823185-136823207 CCTGGTGACCCTCAGGGTCAGGG - Intronic
1203748757 Un_GL000218v1:58933-58955 TCTGGGCACCCTCAGAGCAGCGG + Intergenic
1185433899 X:26141-26163 TCTGGGGCCGCTCAAGGAAACGG - Intergenic
1185443109 X:238208-238230 TCTGGGGCCGCTCAAGGAAACGG - Intergenic
1185609428 X:1385742-1385764 TCTGAGGACACACAGGGAGAAGG + Intergenic
1185811716 X:3116417-3116439 TCTGGGGACTCTGGAGGAAAGGG + Intergenic
1186080410 X:5924839-5924861 TCTGGGGACTCAGAGGGAAAGGG + Intronic
1186935477 X:14446070-14446092 TCTGGGAATCCTGAGGGACATGG + Intergenic
1188449131 X:30290664-30290686 TCTGGGAACCCTCAGGAAGGAGG + Intergenic
1188896589 X:35676590-35676612 TTTGGGGACTCAGAGGGAAAGGG + Intergenic
1188932828 X:36135121-36135143 TTTGGGGACTCGCGGGGAAAGGG + Intronic
1189223759 X:39395619-39395641 CCTGGGGAAGCTCTGGGAAAGGG + Intergenic
1189360550 X:40347337-40347359 TCTGGGGACTCGGGGGGAAAGGG + Intergenic
1189489757 X:41461176-41461198 TTTGGGGACTCAGAGGGAAAGGG - Intronic
1190962709 X:55267991-55268013 ACTAGGGCCGCTCAGGGAAAGGG + Intronic
1193111969 X:77739143-77739165 TTTGGGGACTCAGAGGGAAAGGG - Intronic
1193153814 X:78152178-78152200 TTTGGGGACTCTGGGGGAAAGGG - Intergenic
1193221017 X:78927182-78927204 TTTGGGGACTCTGGGGGAAAGGG + Intergenic
1196268109 X:113676916-113676938 TTTGGGGACTCAGAGGGAAAGGG - Intergenic
1196747465 X:119084604-119084626 TTTGGGGACTCTGAGGGAAAGGG + Intronic
1197551935 X:127902005-127902027 GCTAGGGCCTCTCAGGGAAAGGG + Intergenic
1198182064 X:134219984-134220006 ACTAGGGCCACTCAGGGAAAGGG - Intergenic
1200018180 X:153181042-153181064 TTGGGGGGCCCTCAGGGAGATGG + Intronic
1201269576 Y:12241930-12241952 TCTGGGGACTCTGGGGGAAAGGG - Intergenic