ID: 1089680464

View in Genome Browser
Species Human (GRCh38)
Location 11:120116419-120116441
Sequence GACCGCATGCAGCCTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089680464_1089680474 27 Left 1089680464 11:120116419-120116441 CCAGTGAGAGGCTGCATGCGGTC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1089680474 11:120116469-120116491 TGCTCTAAGCGAGGATGAGCAGG 0: 1
1: 0
2: 2
3: 3
4: 90
1089680464_1089680470 18 Left 1089680464 11:120116419-120116441 CCAGTGAGAGGCTGCATGCGGTC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1089680470 11:120116460-120116482 CTCCTGCCCTGCTCTAAGCGAGG 0: 1
1: 0
2: 2
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089680464 Original CRISPR GACCGCATGCAGCCTCTCAC TGG (reversed) Intronic
905210897 1:36373507-36373529 GAAGGCATGCACCCTCTCCCCGG + Intronic
922214632 1:223510267-223510289 GACAGCATGGAGCCACTCATGGG - Intergenic
1062766306 10:68466-68488 TACAGCATCCAGACTCTCACCGG + Intergenic
1066666636 10:37789641-37789663 GATGGCATTCAGCCTCTCTCTGG + Intronic
1074453217 10:113576144-113576166 GGTCCCAGGCAGCCTCTCACTGG + Intronic
1074481024 10:113820771-113820793 GACCTGATCCATCCTCTCACAGG - Intergenic
1084433776 11:69126286-69126308 GGCCACATGCAGCCCCTCTCTGG + Intergenic
1084456193 11:69269428-69269450 GACCACATGCTGCCTCTGACTGG - Intergenic
1087808010 11:102577269-102577291 GACTACAAGCAGCCTCTAACTGG - Exonic
1089680464 11:120116419-120116441 GACCGCATGCAGCCTCTCACTGG - Intronic
1099359409 12:81681144-81681166 GACTGCATGCTGCTTCACACTGG + Intronic
1101613167 12:106310410-106310432 GACCGCATGAAACCTCTGGCTGG - Intronic
1108110211 13:47063464-47063486 CACTGCATCCAGCCTCTAACTGG + Intergenic
1116436000 14:44896359-44896381 GAAGGCATCCAGCCTCTCCCAGG + Intergenic
1118356258 14:65016426-65016448 GAGCCCATGCTGCCTCTCAGTGG - Intronic
1122284089 14:100640609-100640631 GACCACATCCTGCCTCGCACAGG + Intergenic
1122718948 14:103711688-103711710 GACCCCACCCAGCCTCTCCCAGG + Exonic
1127483706 15:59400291-59400313 GCCCACATCCAGCCACTCACGGG + Intronic
1134115311 16:11543645-11543667 CACCGCATCCAGCCTCCCCCAGG + Intergenic
1134880125 16:17739058-17739080 CACCGCATGTTGTCTCTCACAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143692742 17:8584089-8584111 GGCTGCATGCATCCTCTCTCAGG - Intronic
1152278415 17:79371482-79371504 GACCCCATGCAGTCTATCAGGGG + Intronic
1152816090 17:82408877-82408899 GACCCCCTGCAGCCTCACATGGG + Intronic
1160619324 18:80159926-80159948 GCCCGCAGGCAGCCTCTCCCGGG - Exonic
1162409763 19:10498620-10498642 TACAGCTTGCAGCCTGTCACGGG + Intronic
1163834250 19:19563513-19563535 GACTGCAGGCAGCCTCCCCCAGG + Exonic
1165786221 19:38463525-38463547 GGCTGCAGGCAGCCCCTCACCGG - Exonic
1166976567 19:46608390-46608412 GACTGCAGGGAGCCTCTCTCAGG + Intronic
1167730519 19:51250979-51251001 AAGCCCATGCAGCCTCTCATTGG + Intronic
927056877 2:19373550-19373572 GAGCCCATGCAGCAGCTCACAGG + Intergenic
933349934 2:81140745-81140767 CACCGCATCCAGCCACTAACAGG - Intergenic
934557200 2:95293766-95293788 GACTCCATGCTGTCTCTCACAGG - Intergenic
935950744 2:108326169-108326191 GCTTGCCTGCAGCCTCTCACAGG - Intergenic
947517758 2:230822232-230822254 GACCGCAAGCAGACTGTCAACGG - Intergenic
948382641 2:237561481-237561503 GCCCGCCTGCTGCCTCCCACTGG + Intergenic
1168936291 20:1668568-1668590 CACCGCACCCAGCCTTTCACAGG + Intergenic
1172705051 20:36877012-36877034 GACTGCATGCATCATTTCACGGG + Intronic
1175442609 20:59002117-59002139 GACCGCATCTGGCCCCTCACTGG - Intronic
1176298244 21:5085737-5085759 GAGCTCATGCAGCCCCGCACAGG + Intergenic
1178121625 21:29475425-29475447 GTCCGCATACAGCCTTTCTCTGG + Intronic
1178280666 21:31279949-31279971 GACCGCATGCATCTTCTAGCTGG - Intronic
1179272937 21:39865700-39865722 GACCCCATGGAGGCTCACACTGG + Intergenic
1179858784 21:44176212-44176234 GAGCTCATGCAGCCCCGCACAGG - Intergenic
1181280246 22:21714531-21714553 CACTGCATGCAGCCACTGACGGG + Intronic
1182121518 22:27790341-27790363 GACAGCATGCAGCCTCACCTGGG - Intronic
1183190216 22:36317662-36317684 GACCGCTTTCTGCCTCTCTCCGG - Intronic
1183372831 22:37444622-37444644 GACCGCCTGCAGCCTAGCAAGGG + Intergenic
1183455620 22:37921660-37921682 TACTGGATGCAGCCACTCACTGG + Intronic
1183640992 22:39092285-39092307 GGCAGAAAGCAGCCTCTCACAGG - Intergenic
1184113524 22:42409153-42409175 GAGGGCCTGCAGCCTCTCCCAGG + Intronic
1184251131 22:43260977-43260999 GGCCACCTGCAGCCTCTCCCTGG + Intronic
950132067 3:10554071-10554093 GGCAGCTGGCAGCCTCTCACCGG - Intronic
950959858 3:17094173-17094195 GAACCCAGGCAGCCTCTCAGTGG - Intergenic
962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG + Intronic
969140319 4:5065429-5065451 GACCACTTGCAGCCACTCAGTGG - Intronic
970040182 4:11787588-11787610 GAGCGCATGCTGCCTCTAAATGG + Intergenic
976223788 4:82779346-82779368 GACAGCATGCAGCCTCTACCAGG + Intronic
983538313 4:168881516-168881538 GACCGCAGTCAACCTCTCTCCGG - Intronic
1002417132 5:179126492-179126514 GCCCGCATGCTTCCTCCCACAGG + Intronic
1007924177 6:45638053-45638075 CACCACAAGCAGCCCCTCACAGG - Intronic
1008292993 6:49740811-49740833 CACCGCATCCAGCCCCACACAGG - Intronic
1012959918 6:105611473-105611495 AAAAGCATGCAGCCTCCCACAGG + Intergenic
1013660708 6:112293905-112293927 GTGTGCATGAAGCCTCTCACTGG + Intergenic
1019274864 7:171009-171031 CACCCCATGCAGCCTGTCCCGGG + Intergenic
1019325834 7:437825-437847 GACCGCATCCAGCTTCTCCGGGG + Intergenic
1025490075 7:61105474-61105496 GACTGCATGGAGTCTTTCACTGG + Intergenic
1035638332 8:1163626-1163648 GGCCGCCTGCAGCCTCTCCCGGG - Intergenic
1039488714 8:37931539-37931561 GGCCACCTGCAGGCTCTCACAGG + Intergenic
1046761971 8:118030780-118030802 GACCTCAAGAAGCCTCTAACTGG - Intronic
1047618125 8:126580124-126580146 GACAGCAAGCAGCCTCTCTCTGG - Intergenic
1056521233 9:87403366-87403388 GACTGCTTGCAACATCTCACTGG - Intergenic
1058642393 9:107100301-107100323 GACCACATGCAGCCTTTCTCTGG + Intergenic
1062016111 9:134292193-134292215 GACAGCAGCCAGCCTGTCACAGG - Intergenic
1062697303 9:137881958-137881980 GACCGCAGGGAGCCTCCCAGAGG - Intronic
1190165785 X:48071801-48071823 GACATCATGCAGCCTTTCAGGGG + Intergenic
1191029502 X:55952728-55952750 GTCCTCATTCAGCCTCCCACAGG + Intergenic
1191892418 X:65957554-65957576 GATCACAAGCAGCCTGTCACTGG + Intergenic
1198145552 X:133853038-133853060 TACTCCATGCTGCCTCTCACTGG - Intronic
1199423318 X:147672645-147672667 CACCGCATGCAGCCTTTGATAGG - Intergenic