ID: 1089680550

View in Genome Browser
Species Human (GRCh38)
Location 11:120116798-120116820
Sequence AGATAGAGAGTATGCTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089680541_1089680550 12 Left 1089680541 11:120116763-120116785 CCAAGACACCCGCCTTGTGCAGC 0: 1
1: 0
2: 2
3: 15
4: 125
Right 1089680550 11:120116798-120116820 AGATAGAGAGTATGCTGGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 260
1089680544_1089680550 3 Left 1089680544 11:120116772-120116794 CCGCCTTGTGCAGCAGGCAGAAG 0: 1
1: 0
2: 4
3: 26
4: 260
Right 1089680550 11:120116798-120116820 AGATAGAGAGTATGCTGGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 260
1089680545_1089680550 0 Left 1089680545 11:120116775-120116797 CCTTGTGCAGCAGGCAGAAGTCC 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1089680550 11:120116798-120116820 AGATAGAGAGTATGCTGGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 260
1089680540_1089680550 13 Left 1089680540 11:120116762-120116784 CCCAAGACACCCGCCTTGTGCAG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1089680550 11:120116798-120116820 AGATAGAGAGTATGCTGGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 260
1089680543_1089680550 4 Left 1089680543 11:120116771-120116793 CCCGCCTTGTGCAGCAGGCAGAA 0: 1
1: 0
2: 2
3: 24
4: 290
Right 1089680550 11:120116798-120116820 AGATAGAGAGTATGCTGGGGTGG 0: 1
1: 0
2: 0
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089680550 Original CRISPR AGATAGAGAGTATGCTGGGG TGG Intronic
904314719 1:29652790-29652812 AGATAGAGAGTCTGGGGGAGAGG + Intergenic
904673697 1:32184414-32184436 AAATATAAAGTATGATGGGGAGG + Intronic
905931219 1:41788915-41788937 AGATAGAAAGGATACAGGGGTGG - Intronic
906588722 1:47003647-47003669 AGAGAGAGAGTAGGGTGGGGAGG + Intergenic
907280920 1:53346582-53346604 GGATACAGAGGATGCTGGGCTGG + Intergenic
908517340 1:64906427-64906449 TGAGAGAGTGAATGCTGGGGAGG - Intronic
908721292 1:67129082-67129104 TGATAGAGGGCATGCTGGGATGG - Intronic
909372171 1:74896881-74896903 AAATAGAGAGAATGGAGGGGAGG - Intergenic
909786594 1:79621558-79621580 AAAGAGAGAGAATGCTGGGTAGG + Intergenic
909990735 1:82220082-82220104 AAATAGAGACTTTGTTGGGGTGG + Intergenic
911631735 1:100191420-100191442 GGATAGAGAGGAAGCTGAGGTGG - Exonic
915205792 1:154269577-154269599 AGATAAAGAGGGTGTTGGGGAGG - Intronic
917680481 1:177361125-177361147 AGATAAAGAGTATGGTGAGAAGG + Intergenic
918266878 1:182850970-182850992 AGATAGAGAGTGAGGTGGAGGGG + Intronic
918354439 1:183693510-183693532 AGAAAGAGAGTAAGGAGGGGAGG - Intronic
920135435 1:203765450-203765472 AGATAGGGAGTTTGTTGCGGGGG + Exonic
920278952 1:204829006-204829028 AGATAGAAAGGGTGTTGGGGTGG - Intronic
920414820 1:205791852-205791874 ACACAGAGAGGTTGCTGGGGTGG - Intronic
921754839 1:218842872-218842894 AGAGAGAGAGAATGAAGGGGAGG - Intergenic
923341041 1:233007385-233007407 AGAAAGAGAGTAAGATGGGTGGG + Intronic
924291289 1:242539108-242539130 AGAGAGAGAGGATGGTGGTGAGG - Intergenic
924507421 1:244698964-244698986 AGGTAGAGAGTAAGATGGGTAGG - Intronic
1063343471 10:5290540-5290562 AGCTAAAGAGTATGCAGGGAAGG - Intergenic
1065363942 10:24916691-24916713 AGAGACAGAGTAGGCTGGAGGGG - Intronic
1067859753 10:49833361-49833383 TGAGAGAGAGAATGCTGAGGAGG - Intronic
1068293723 10:55039084-55039106 AGAGAGGGAATATGCTGGTGTGG - Intronic
1068370195 10:56103084-56103106 AGGTAGAGAGTTTGGTTGGGAGG - Intergenic
1069389574 10:67919275-67919297 ACCTAGAAAGTTTGCTGGGGAGG - Intergenic
1074276382 10:112006278-112006300 AGAGAGAGAGGATCCTGGGCTGG - Intergenic
1074413757 10:113249486-113249508 AGGTAGAGAAAAGGCTGGGGAGG + Intergenic
1074786615 10:116847823-116847845 AGATTGCGAGTATCCTGGGCTGG - Intergenic
1075118679 10:119648579-119648601 AGAAAGAGAGAATGTTTGGGAGG - Intergenic
1075118815 10:119649556-119649578 AGATTCAAAGTATGCAGGGGCGG - Intergenic
1076064717 10:127440145-127440167 AGAAAGAGAGTATGGGTGGGGGG + Intronic
1076078438 10:127556225-127556247 GGAGAGAGAGAATGCTGGTGTGG + Intergenic
1076298908 10:129409693-129409715 CCATAGATAGTATGCTGGGAAGG - Intergenic
1079087872 11:17460326-17460348 AGATGTAGAGTATTCTGTGGTGG + Intronic
1079498733 11:21076810-21076832 AGAGAGAGAGAAAGATGGGGAGG - Intronic
1082771836 11:57213753-57213775 AGATCGAGAGCATGATGGGCAGG - Intergenic
1083106445 11:60362868-60362890 AGGTAGAGAGCCTGCTGGTGCGG + Intronic
1084359265 11:68659212-68659234 AGATACAGATGATGCTGAGGAGG - Intergenic
1084537952 11:69768871-69768893 AGAGAGAGAGCAGGATGGGGAGG - Intergenic
1084923866 11:72495935-72495957 AGATAGAGAGTAGAATGGTGGGG + Intergenic
1085872231 11:80364077-80364099 AGAGAGAGAGAATGGTAGGGAGG - Intergenic
1087889669 11:103522860-103522882 ACATAGACAGTAAGCTGTGGGGG - Intergenic
1089275629 11:117333886-117333908 AGTTGGATAGGATGCTGGGGAGG - Intronic
1089680550 11:120116798-120116820 AGATAGAGAGTATGCTGGGGTGG + Intronic
1089804358 11:121069823-121069845 TGATACATATTATGCTGGGGAGG + Intronic
1089903029 11:122008130-122008152 AAATAGAGAATATGTTAGGGAGG - Intergenic
1090385324 11:126355122-126355144 AGATAAAGAGTATGCAAGTGAGG + Intergenic
1090394687 11:126411045-126411067 AGATGGAGAGGAGGCTGGAGAGG + Intronic
1091637848 12:2211556-2211578 AGAAGGAGAGTCTGCTGGTGGGG - Intronic
1091709968 12:2732734-2732756 AGAGAGAGGGTATGTTGTGGTGG - Intergenic
1091804726 12:3347705-3347727 AGATAGAGATGACGCTGGGCTGG + Intergenic
1093850796 12:24035321-24035343 ATATAGAGAATATGCTTGGCAGG - Intergenic
1094488330 12:30942305-30942327 AGATGGAGATGATGCTGGGCTGG - Intronic
1096476116 12:51910246-51910268 AGATGGGGAGTATCCTGGGTGGG + Intronic
1096651650 12:53064839-53064861 AGATAGAGGGCTTGGTGGGGAGG + Exonic
1098283857 12:68888507-68888529 AGATAGCCAGTAAGCTGGAGAGG - Intronic
1101830650 12:108253852-108253874 AGAGAGAGAGGATGGGGGGGCGG + Intergenic
1102504827 12:113377386-113377408 GGACAGAGATGATGCTGGGGTGG - Intronic
1102676428 12:114662579-114662601 AGATAGAGAGAATGGTGGCAAGG - Intergenic
1103035073 12:117649990-117650012 AGAGAGAATGAATGCTGGGGAGG - Intronic
1104675313 12:130708572-130708594 AGATACAAAGGATGCTGAGGTGG + Intronic
1104743691 12:131196572-131196594 AGAAAGAGTGCATCCTGGGGTGG + Intergenic
1105323589 13:19349920-19349942 AGCTAGAGATTATGCAGAGGAGG + Intergenic
1105811398 13:23999472-23999494 AGATAGACTGTATGATGGGTTGG - Intronic
1106070675 13:26407813-26407835 AGAGAGGGAGAACGCTGGGGTGG - Intergenic
1106468672 13:30035799-30035821 ACAGAGAGAGGAGGCTGGGGAGG - Intergenic
1106500520 13:30324123-30324145 AGATTGTGTGTGTGCTGGGGAGG + Intergenic
1107862005 13:44670048-44670070 GGATAGAGGCTATGCTGGTGGGG + Intergenic
1107914003 13:45130954-45130976 AGATTGAGAGTATACAGGGCTGG + Intronic
1107980846 13:45732750-45732772 AGATGGAGTGAAGGCTGGGGTGG - Intergenic
1108155434 13:47579305-47579327 AGAGAGAGAGTTTGGGGGGGAGG + Intergenic
1109559250 13:64025344-64025366 AGATACACAGTGTGCTGGGTTGG + Intergenic
1115011754 14:28556604-28556626 AGATAGAGAGTAGGAGGAGGTGG - Intergenic
1115186709 14:30697052-30697074 ATATAGATTGTATGTTGGGGGGG + Intronic
1115606495 14:35008075-35008097 AGATCTATAGTATGCTGGGTGGG - Intronic
1115761959 14:36583990-36584012 TGATAGGGAGGCTGCTGGGGAGG - Intergenic
1115779708 14:36756037-36756059 AGCTTGATAGAATGCTGGGGTGG + Intronic
1121563587 14:94892601-94892623 GGATGGAGAGTAGGCTGGGCTGG + Intergenic
1122310577 14:100791789-100791811 AGATTGAGAGGATGCTGGCCTGG - Intergenic
1122818069 14:104323808-104323830 AGATGGAGAGTCGGTTGGGGCGG + Intergenic
1123389280 15:19853249-19853271 AGAGAGAGAGTATGGTAGTGGGG + Intergenic
1125988123 15:44075658-44075680 AAACAGAGAATATGCAGGGGAGG - Intronic
1126696492 15:51330164-51330186 AGAGAGAGAGTAGGCAGGGGTGG + Intronic
1127855205 15:62948422-62948444 AGAAAGAGAGCATGGTGTGGCGG - Intergenic
1129234857 15:74217958-74217980 AGATTGTGGGTATGTTGGGGTGG + Intergenic
1130120509 15:81043398-81043420 AGATCTAGAGAATGCTGGAGGGG + Intronic
1133816533 16:9201768-9201790 AGAGAGAGAGAAAGATGGGGTGG + Intergenic
1134200820 16:12197220-12197242 AGATTGGGAGTAGGCTGGGCTGG + Intronic
1134902537 16:17951525-17951547 AGACAGAGAGTATGTCTGGGTGG - Intergenic
1135475010 16:22766204-22766226 AGCAAGTGAGTATGCTGTGGAGG + Intergenic
1136383161 16:29906456-29906478 AGGTAGGGAGGATGGTGGGGAGG + Exonic
1136755896 16:32683177-32683199 AGATAGTGAGAAGGCGGGGGTGG - Intergenic
1136812216 16:33187195-33187217 AGATAGTGAGAAGGCGGGGGTGG + Intergenic
1136818692 16:33297275-33297297 AGATAGTGAGAAGGCGGGGGTGG + Intronic
1136825256 16:33353808-33353830 AGATAGTGAGAAGGCGGGGGTGG + Intergenic
1136830322 16:33452579-33452601 AGATAGTGAGAAGGCGGGGGTGG + Intergenic
1137361359 16:47818988-47819010 AGAGAGAGAGTACGGTAGGGGGG - Intergenic
1137984019 16:53092602-53092624 AGACACAGAGTTTGCTAGGGAGG - Intronic
1139833608 16:69820628-69820650 AGAAACAGGGAATGCTGGGGAGG - Intronic
1140622075 16:76746928-76746950 AAAGAGAGAGTCTGCTGGGCCGG + Intergenic
1140951452 16:79822382-79822404 AGAGAGGGAGAATGATGGGGTGG + Intergenic
1141241238 16:82266955-82266977 AGATAGAGAGGGGGCTGGGGAGG - Intergenic
1141926114 16:87170699-87170721 AGAGAGAGAGTTTGCGGTGGAGG - Intronic
1202990794 16_KI270728v1_random:10165-10187 AGATAGTGAGAAGGCGGGGGTGG + Intergenic
1142691004 17:1606061-1606083 AGAAAGAGAGGAAGGTGGGGAGG + Intronic
1143711182 17:8736337-8736359 GGATAGAGAGGGTGCTGGTGGGG + Intronic
1144444656 17:15315644-15315666 AGATAGGGGGTTGGCTGGGGAGG + Intronic
1144538793 17:16117870-16117892 AGAAAGTGAGTATATTGGGGTGG - Exonic
1147591076 17:41683729-41683751 AGCGAGAGAGAATCCTGGGGAGG - Intergenic
1147908685 17:43841193-43841215 AAAAAGAAAGTATACTGGGGAGG - Intergenic
1148126438 17:45239645-45239667 AGGTAGAGAGCAGGCTGGCGGGG + Intronic
1148645466 17:49217645-49217667 AGATAAAGACTGGGCTGGGGGGG - Intronic
1150281405 17:63931444-63931466 ACATAGAGGGCATGCAGGGGTGG - Intronic
1151575321 17:74950195-74950217 AGAGAGAGGGTGTGCTGGGGAGG - Intergenic
1152466441 17:80469343-80469365 AGAAAGAGAGCAGGCTCGGGAGG - Exonic
1156368864 18:36454696-36454718 AGACAGAGAGGTTGCAGGGGTGG - Intronic
1158316259 18:56214157-56214179 AGAGAGAGAGTGAGTTGGGGAGG - Intergenic
1159586033 18:70284467-70284489 ACATAGAGAGAACTCTGGGGAGG - Intergenic
1159745264 18:72226088-72226110 AGACAGAGATAATGCTGGGCAGG + Intergenic
1160197240 18:76766075-76766097 AGAGAGAGAGGAAGATGGGGAGG - Intergenic
1160308085 18:77759922-77759944 AGAGAGAAAGCATGCTGAGGAGG + Intergenic
1162661965 19:12176786-12176808 GGAGAGAGAGAAAGCTGGGGAGG + Intronic
1163241791 19:16067974-16067996 AGAGAGAGAGTTGGCGGGGGAGG + Intronic
1164724080 19:30453456-30453478 ATATTGTGAGTATGATGGGGTGG + Intronic
1165709413 19:37999460-37999482 AACTAGAGAGAAGGCTGGGGCGG - Intronic
927043870 2:19257316-19257338 TGACAGAGAGGATTCTGGGGAGG - Intergenic
927710484 2:25322703-25322725 AGATGGAGAGGAGGCTTGGGTGG - Intronic
929452191 2:42045523-42045545 AGACAGTGAGTATGCGAGGGAGG + Intergenic
929554666 2:42918326-42918348 AGAGAGAGAGTATCCTAGGTTGG + Intergenic
931170233 2:59795402-59795424 AGAGAGAGACTGTGTTGGGGAGG - Intergenic
932234907 2:70113105-70113127 AGATAGAGGGTGGGCTGGAGGGG - Intergenic
932616252 2:73233449-73233471 ACCCGGAGAGTATGCTGGGGCGG - Intronic
932878753 2:75479928-75479950 AGAGAGAGAGGATGGTGGGAGGG - Intronic
933437436 2:82265784-82265806 AGAGAGAAAGTGTGATGGGGAGG + Intergenic
935004407 2:99057684-99057706 TGATAGAGACTATGCTGAGCTGG - Intronic
937313265 2:120915158-120915180 AAAGAGAGAGTGTGCTGGGCTGG - Intronic
938104812 2:128522575-128522597 AGAGAGAGAGGATGCAGGTGTGG - Intergenic
939250234 2:139673099-139673121 GGATAGAGAGTTTGCTTGGAAGG + Intergenic
939850870 2:147302818-147302840 AGATAGAGTTTCTGCTGTGGAGG - Intergenic
940608182 2:155954853-155954875 AGAGAGAGAAAATGCTGGTGGGG + Intergenic
941600897 2:167543441-167543463 AGATATAAGGTATGCTGGGATGG + Intergenic
945212947 2:207402480-207402502 AGAGAGAGAGAGTGCAGGGGAGG - Intergenic
945859710 2:215106725-215106747 AGATAAAGGGTATGCTTTGGAGG + Intronic
947818588 2:233054899-233054921 AGAGAGAGAGAAGGCTGGGTGGG + Intergenic
948891983 2:240911672-240911694 AGACAGAGAGTAGGATGGTGGGG - Intergenic
1170820202 20:19751222-19751244 AGGAAGAGAGAGTGCTGGGGAGG - Intergenic
1173440307 20:43069612-43069634 AGGAAGAGACTTTGCTGGGGAGG + Intronic
1173840780 20:46155531-46155553 GGATAGAGAGAGTGCTGGAGAGG - Intergenic
1173858583 20:46267550-46267572 GGAAGCAGAGTATGCTGGGGCGG - Intronic
1174648025 20:52102997-52103019 AGATAGAGCCTCTGATGGGGAGG + Intronic
1174735723 20:52964002-52964024 AGATAGAGAGTACGGGGGTGGGG - Intergenic
1174775303 20:53338287-53338309 AGATAGAGAGCATGATGGTTTGG - Intronic
1175112286 20:56657117-56657139 TGATAGAGAGGATGCTGGTGAGG - Intergenic
1175114659 20:56673657-56673679 AAATAGAGAGAATGCTAGTGGGG + Intergenic
1175299023 20:57929778-57929800 AGACAGAGAGATGGCTGGGGTGG + Intergenic
1176162201 20:63653582-63653604 AGAGAGAGAGACTGCGGGGGCGG + Intergenic
1176239125 20:64067835-64067857 AGATGGACAGGTTGCTGGGGAGG + Intronic
1177162520 21:17563423-17563445 AGATGGGGAGGATGTTGGGGGGG + Intronic
1178471659 21:32899072-32899094 AGATAGTGAATATACTGTGGAGG + Intergenic
1180016724 21:45091543-45091565 AGACAGAGATCATGCTGGTGGGG - Intronic
1180847358 22:18991188-18991210 AGATGGGGTGTATGCTTGGGAGG - Intergenic
1180979478 22:19871940-19871962 AGAATGGGAGTGTGCTGGGGTGG - Intergenic
1181327191 22:22058843-22058865 AGGCAGAGAGAATGCAGGGGAGG - Intergenic
1184378192 22:44128360-44128382 AGAAAGAGAGAAAACTGGGGAGG - Intronic
1184733066 22:46381568-46381590 AGATGGGGTGTATGCTGGGGAGG + Intronic
949339223 3:3010425-3010447 AGACAGAGAGAATGGTTGGGAGG - Intronic
950094276 3:10319785-10319807 AGAGAGAGAGAAGGCGGGGGGGG + Intronic
950660698 3:14465158-14465180 AGACAGAGATTATGCCTGGGAGG - Intronic
951366378 3:21788180-21788202 AGAAAGATAGTAAGATGGGGCGG + Intronic
951887590 3:27539242-27539264 AAAAAAAGAGTATACTGGGGTGG + Intergenic
952285945 3:31969913-31969935 AGAGAAAGAGTATGCGGGGGTGG + Intronic
953061281 3:39430291-39430313 GGAGAGAGACTATGCTGGGGAGG + Intergenic
955244595 3:57212696-57212718 TGATAGCCAGTAAGCTGGGGAGG - Intronic
955304555 3:57816843-57816865 AGGTAGAGAGTATGAGTGGGTGG + Intronic
959570874 3:107882461-107882483 AGAGAGAATGAATGCTGGGGAGG - Intergenic
961629726 3:128287404-128287426 AGAGAGTGAGGAGGCTGGGGAGG + Intronic
962986939 3:140544742-140544764 AGAGAGAGGGTATGCAGGGGAGG + Intronic
963076608 3:141353180-141353202 AGACAGAGAGATTGATGGGGAGG - Intronic
965064503 3:163829266-163829288 CAAGAGTGAGTATGCTGGGGTGG + Intergenic
966822753 3:183937938-183937960 TGATAGAGAGTTTGCTTCGGAGG + Exonic
967548137 3:190756978-190757000 ATATAGAGAGGAGGCTGAGGTGG - Intergenic
967989110 3:195118305-195118327 AGATACAGAGCAGGGTGGGGAGG + Intronic
969429474 4:7145737-7145759 AGATAGTGAGTCTGCGGGGGAGG + Intergenic
969447780 4:7255469-7255491 GGAGAGAGGGTGTGCTGGGGAGG + Intronic
971920991 4:32938908-32938930 GGATTGAGATTATCCTGGGGAGG + Intergenic
972160905 4:36226301-36226323 AAATAGTAAGTATGCTGGAGTGG - Intronic
972632928 4:40857343-40857365 AGGAAGGGAGTATGTTGGGGTGG - Intronic
973635419 4:52857727-52857749 AGAGAGAGAGAAAGCAGGGGGGG - Intergenic
975116814 4:70688956-70688978 AGATGGAGGGAATGCGGGGGAGG + Exonic
975301431 4:72795681-72795703 GGATAGAGAGTGGGCTGGGGTGG - Intergenic
975431362 4:74295184-74295206 AGAAAGAGAGGAGGCCGGGGAGG - Intronic
978709682 4:111764433-111764455 GCATAGAGAACATGCTGGGGTGG + Intergenic
978983550 4:114982021-114982043 AGAGAGAGAGTGTGTTTGGGGGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980586811 4:134828760-134828782 AGATATGGAGAATGGTGGGGTGG - Intergenic
981239992 4:142465841-142465863 AGAGAGGGAGCAAGCTGGGGAGG - Intronic
982284318 4:153718815-153718837 AGATAGAGCCTATGGTGGAGGGG + Intronic
983382660 4:167017380-167017402 AGTTAGTGACTATGCTGGGTAGG - Intronic
983931495 4:173457863-173457885 TAATGGAGAGGATGCTGGGGTGG - Intergenic
984869006 4:184310621-184310643 AGATCGACAGGAAGCTGGGGTGG - Intergenic
985095774 4:186411614-186411636 AGAAAGAGATTAGGGTGGGGAGG + Intergenic
987967501 5:24894835-24894857 AGATAGAGAACATGATGGGGGGG + Intergenic
991403262 5:66276469-66276491 AGAGAGAGAGTATGTTGGAGTGG + Intergenic
993905930 5:93622604-93622626 GGATAGAGAGAATCCTTGGGAGG - Intronic
994581046 5:101642283-101642305 AGAAAGAGAGAATGCAGGGTAGG - Intergenic
997451072 5:133983863-133983885 AGAGAGAGAGAGTGGTGGGGAGG - Intronic
997527055 5:134560255-134560277 AGTTAGTGAGCATGCAGGGGAGG + Intronic
998104988 5:139462731-139462753 AGAGAGAGGGAGTGCTGGGGCGG + Exonic
999559445 5:152785097-152785119 AGAGAAAGTGTATGCTTGGGAGG + Intergenic
999819429 5:155210756-155210778 AGAAAGAGGCCATGCTGGGGTGG - Intergenic
999871912 5:155761404-155761426 TGATAGAGAGGATGATGGAGAGG - Intergenic
1001630179 5:173169078-173169100 AGAAGAAGAGGATGCTGGGGTGG + Intergenic
1001831286 5:174791358-174791380 GGTTAGAGAGTAAGATGGGGTGG + Intergenic
1001880277 5:175237623-175237645 AGGTGAAGAGAATGCTGGGGAGG + Intergenic
1003320327 6:5045424-5045446 AGATAGAAAGTAGACTGGGGTGG + Intergenic
1005499946 6:26421095-26421117 AGAGGGAGATTTTGCTGGGGAGG - Intergenic
1006749484 6:36367625-36367647 AGAGAGACAGTATGGTGGGGTGG + Intronic
1006856556 6:37137745-37137767 AGAAAGAAAGAGTGCTGGGGCGG - Intergenic
1007338905 6:41176885-41176907 AGATATAGAGGATGCAGTGGAGG + Intergenic
1007359509 6:41345025-41345047 AGAGAGAGAGTGTGCAGTGGGGG - Intronic
1007696648 6:43737918-43737940 AGAGAGAGAGCCTGCTGAGGGGG + Intergenic
1008402932 6:51084969-51084991 AGATAGAGAGTGGGATGGGGAGG - Intergenic
1008837505 6:55853331-55853353 AGAGAGAGAGAAAGCGGGGGAGG - Intronic
1012195564 6:96336619-96336641 AGAAAGAGAGCTTGTTGGGGGGG - Intergenic
1012944164 6:105448328-105448350 TCATAGATAGGATGCTGGGGAGG - Intergenic
1016256709 6:142115284-142115306 AGATGGAGAGTATAGTGGGAGGG + Intergenic
1017935863 6:159004354-159004376 TGATAGAGGGAACGCTGGGGAGG + Intergenic
1017946780 6:159102434-159102456 AGACAGAGAGGGTGCTGGGCAGG - Intergenic
1019642571 7:2112177-2112199 AGACAGAAAGCATGCTGGGGTGG + Intronic
1019960278 7:4453782-4453804 AGAGAGAGATTATGCTGCCGTGG + Intergenic
1020260827 7:6529930-6529952 AGAGAGAGAGAAAGCTGGGTGGG - Intronic
1022096924 7:27147002-27147024 AGAGAGAGAGGCTGGTGGGGAGG - Intronic
1022123525 7:27333591-27333613 AGAAAGAGAGTATGATGTGAAGG + Intergenic
1023832430 7:44047452-44047474 AGATACGGAGTAAGCAGGGGCGG - Intronic
1027513055 7:79107733-79107755 AGATAGAGAGGATGATGGTTTGG - Intronic
1027672231 7:81116174-81116196 TGATACAGAGTATGTTGGGAAGG - Intergenic
1028125568 7:87108674-87108696 AGAAACAGAGTCTGCTGGGTTGG + Intergenic
1028646445 7:93102563-93102585 AGATAGAGAGTATGAAGTGAAGG - Exonic
1029142950 7:98424605-98424627 AGATAGACAGCATGCAGGGGTGG + Intergenic
1029495091 7:100892300-100892322 AGAGGGAGAGAAGGCTGGGGAGG - Intronic
1030834360 7:114264839-114264861 AGAGAGAGAGTGTGCGGGGTGGG + Intronic
1031969437 7:128053629-128053651 AGAGAGAGTGTTTTCTGGGGTGG + Intronic
1032257159 7:130306393-130306415 AGAAAGAAAGTCTGCTGGGAGGG + Intronic
1032389894 7:131549140-131549162 AGGAAAAGAGTGTGCTGGGGGGG + Intronic
1032546566 7:132748719-132748741 AGATGGGGAGTAGTCTGGGGGGG - Intergenic
1033064309 7:138139055-138139077 ATATATAGAGAATGTTGGGGAGG - Intergenic
1033316027 7:140298458-140298480 AGCTAGAGAGGAAGGTGGGGAGG - Intronic
1033542388 7:142369022-142369044 AGAAAGAGAGTGTGTGGGGGAGG + Intergenic
1034914898 7:155029405-155029427 AGATAGAGAGTAGAATGAGGGGG - Intergenic
1034948286 7:155278705-155278727 AGATATAGATTATGATGGGGTGG - Intergenic
1036009138 8:4701430-4701452 AGCTGGAGAGTCTGATGGGGAGG + Intronic
1041177249 8:55209504-55209526 AGGTAGAGAGTATTGTGGGGAGG + Intronic
1041243850 8:55872578-55872600 ATATTGAGAGTATTTTGGGGTGG - Intergenic
1042147065 8:65740784-65740806 AGAGAGAGAGATTGGTGGGGTGG - Intronic
1042887219 8:73565290-73565312 AGAGAGAGAGCAAGCAGGGGAGG - Intronic
1043497474 8:80818046-80818068 AGGTAGAGAGTAAGGTGGGAAGG + Intronic
1044062420 8:87654377-87654399 AGATACAGAATATACTGGGAAGG + Intergenic
1044483788 8:92725314-92725336 ACAGAGAGAATATGTTGGGGTGG + Intergenic
1045124617 8:99075368-99075390 AGCAAGAGAGAGTGCTGGGGAGG + Intronic
1047078070 8:121427030-121427052 AGGTAGAGAGTATGCTGCCATGG - Intergenic
1047158515 8:122349866-122349888 AGAGAGAGAGAAGGGTGGGGGGG - Intergenic
1047581243 8:126218459-126218481 ATGGAGAGGGTATGCTGGGGTGG + Intergenic
1047615767 8:126561391-126561413 AGACATAGAGGATGCTGGGGCGG + Intergenic
1048575014 8:135683392-135683414 AGAGAGAGTGGATGCTGGGTAGG + Intergenic
1049466464 8:142753200-142753222 GGATAGAGAGTGGGGTGGGGAGG + Intergenic
1049692221 8:143966477-143966499 AGGTAGAGAGCAGCCTGGGGTGG - Intronic
1056300276 9:85233110-85233132 AGAAACAGAGTATGCTAGGGTGG - Intergenic
1056705312 9:88947351-88947373 AGAGAGAGATTCTGCTGGGGAGG - Intergenic
1057296609 9:93848361-93848383 GAATAGAGAGGAAGCTGGGGTGG + Intergenic
1058601857 9:106679053-106679075 AGAGAGAAAGGAGGCTGGGGAGG - Intergenic
1058852791 9:109028636-109028658 AAAAAGAGATTATGCTGGGTGGG + Intronic
1059728275 9:117030266-117030288 GGAAAGAGAGAATGCTGGGTGGG - Intronic
1188556849 X:31421846-31421868 AGAGAGAGAGTAAGCAGGGAGGG - Intronic
1189655119 X:43236966-43236988 GGTTAGTGAGTATGCTGGGAAGG - Intergenic
1192337412 X:70233692-70233714 ACATGGAGAGCATCCTGGGGTGG + Intergenic
1193724675 X:85025165-85025187 AGACAGAGAGTATGTGGGGAGGG + Intronic
1193868148 X:86762440-86762462 AAAGAGAGAATATGGTGGGGTGG - Intronic
1194150947 X:90324578-90324600 AGATAGAGAGCAAAGTGGGGAGG + Intergenic
1196545041 X:116952832-116952854 AGAGAGAGAGTATGGTGTAGTGG + Intergenic
1197963250 X:132028748-132028770 AGAGAGAGAGTTAACTGGGGTGG + Intergenic
1200497313 Y:3901337-3901359 AGATAGAGAGCAAAGTGGGGAGG + Intergenic