ID: 1089683750

View in Genome Browser
Species Human (GRCh38)
Location 11:120133935-120133957
Sequence TGGGGGGCCCTGCACTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089683750_1089683757 4 Left 1089683750 11:120133935-120133957 CCATGACAGTGCAGGGCCCCCCA 0: 1
1: 0
2: 1
3: 18
4: 183
Right 1089683757 11:120133962-120133984 CAGCCAGCCGTCCACCCAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 204
1089683750_1089683756 1 Left 1089683750 11:120133935-120133957 CCATGACAGTGCAGGGCCCCCCA 0: 1
1: 0
2: 1
3: 18
4: 183
Right 1089683756 11:120133959-120133981 GAGCAGCCAGCCGTCCACCCAGG 0: 1
1: 0
2: 5
3: 21
4: 271
1089683750_1089683762 18 Left 1089683750 11:120133935-120133957 CCATGACAGTGCAGGGCCCCCCA 0: 1
1: 0
2: 1
3: 18
4: 183
Right 1089683762 11:120133976-120133998 CCCAGGAGGTCTTAACATCCTGG 0: 1
1: 0
2: 2
3: 15
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089683750 Original CRISPR TGGGGGGCCCTGCACTGTCA TGG (reversed) Intronic
901007624 1:6179631-6179653 TGGGGGGCGCGGCGCTGTCAGGG - Intronic
901082580 1:6591876-6591898 ATGGGGGCCCAGCACTGTCCAGG - Exonic
901595237 1:10379836-10379858 TGGCTGGCCCTGCACAGTCCTGG - Intronic
901604893 1:10451451-10451473 TGAGGGGCCCGGCACTGGCCTGG - Exonic
901629908 1:10642992-10643014 TGGGGGGCCCTGAAAGGACACGG + Exonic
903172559 1:21563133-21563155 TGGCGGTGCCGGCACTGTCAGGG - Exonic
904676592 1:32202439-32202461 TTGGGGGCCCTGGAGTATCAGGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906077906 1:43065494-43065516 ATCGGGGCCCTGCACAGTCAAGG - Intergenic
915623219 1:157098739-157098761 TGGGGGCCCCTGCCCTGTGTCGG - Exonic
915691471 1:157695349-157695371 CTGGGGGCCCAGCACAGTCATGG - Exonic
916246770 1:162696390-162696412 AGGGGGGCCCTGGCCTTTCAGGG - Intronic
918139684 1:181709868-181709890 TGGGAGGCACTGCACTGGTAAGG + Intronic
918275282 1:182948165-182948187 TGCAGGGCCCTGCACTGTTCAGG + Intronic
920656485 1:207879378-207879400 TGGGGGACCCTGGAGTATCAAGG - Intergenic
922657442 1:227398476-227398498 TGAAGGGCACTGCACTGTAAGGG + Intergenic
1063427529 10:5961693-5961715 TGGCTGCCCCTGCACTGTAAGGG + Intronic
1064200087 10:13276874-13276896 TGGGGAGCCCTGCTTTGTTATGG - Intergenic
1065615179 10:27513768-27513790 AGGGGGGCCTTGCAGTTTCATGG - Intronic
1071339907 10:84636083-84636105 TGTGATGCCCTGCACTGTCTTGG + Intergenic
1074852248 10:117448210-117448232 TAGGGGGGCCTGCATTGTCCTGG + Intergenic
1075298224 10:121296856-121296878 TGGGGGACCCTGCAGTGGCTGGG - Intergenic
1075298885 10:121302710-121302732 TGGGGGACCCTGCCCTCTCTTGG - Intergenic
1076314118 10:129528707-129528729 TGTTGGGCCCTGATCTGTCAAGG + Intronic
1076882475 10:133246227-133246249 TGGGGGGCACTGGTCTGTCCTGG - Intergenic
1077131820 11:976740-976762 TGGAGGGCCCTGCACCGCCATGG - Intronic
1077338561 11:2016139-2016161 TGGGGGTCCCTGCAAGGTCCAGG - Intergenic
1077339893 11:2021570-2021592 AGGGGGGCTCAGCACTGCCATGG + Intergenic
1084564623 11:69921972-69921994 TGAGGGGCCCAGCACAGACAAGG + Intergenic
1085482556 11:76834846-76834868 TGGGGGGCGCTCCACTCTCATGG - Intergenic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1090802118 11:130179510-130179532 TGCTGGGCCCTGGACTGCCATGG + Intronic
1202821545 11_KI270721v1_random:71321-71343 TGGGGGTCCCTGCAAGGTCCAGG - Intergenic
1202822878 11_KI270721v1_random:76759-76781 AGGGGGGCTCAGCACTGCCATGG + Intergenic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1096514265 12:52147592-52147614 AGGGGGGCCCTCCGCTCTCAGGG - Intergenic
1102298347 12:111754153-111754175 TGGGTGGCCCTGGACTCCCAGGG + Intronic
1102525892 12:113512201-113512223 TGGGGGGCCCTGCAGAGCTAGGG + Intergenic
1103567487 12:121823764-121823786 TGGGGGGCTCTGCACCTTCTGGG + Intronic
1110728398 13:78852761-78852783 TGGGGGCCACTTCACTGTTAGGG - Intergenic
1113617969 13:111694499-111694521 GCGGGGTCCCTGCACTGTCTTGG + Intergenic
1113623502 13:111779760-111779782 GCGGGGTCCCTGCACTGTCTTGG + Intergenic
1113877131 13:113601539-113601561 TGGGGGCCCCTGCAGGGCCAGGG + Intronic
1116900944 14:50362001-50362023 TGGGGGGCCCGGCACTCTAGCGG + Intronic
1118466318 14:66034428-66034450 TGGGAGGCTCTGCAGAGTCAGGG + Intergenic
1118805932 14:69236953-69236975 TCAGGGCCCCTGCACTGTGAGGG + Intronic
1118839442 14:69500018-69500040 TTGGGGGCCCTGGACTCACATGG - Intronic
1119895304 14:78214857-78214879 TGGGGGGCCTTGCGTGGTCACGG + Intergenic
1122857933 14:104568861-104568883 GGGTGGGCCCTGCACCTTCAGGG + Intronic
1122953155 14:105056859-105056881 AGGGGAGCCCTGCACGGTCTGGG - Intronic
1122973805 14:105162959-105162981 TCTAGGGCCCTGCACGGTCAAGG + Intronic
1123026270 14:105425783-105425805 TGGGTGGCCTTGCACTATGAGGG - Intronic
1125507748 15:40276806-40276828 TGGAGGGACCTGGGCTGTCAAGG - Exonic
1127364166 15:58271881-58271903 TCCAGGGCCCTGTACTGTCAAGG - Intronic
1127553138 15:60060769-60060791 TGGGGAGCACTGGACTCTCAGGG + Intronic
1127781846 15:62323456-62323478 TGGGTTGTCCTGCACTGTCTTGG + Intergenic
1128943159 15:71804989-71805011 GCGGGGGCCCTGCCCTGTCCTGG - Intronic
1128979846 15:72178222-72178244 TGGGGTTCCCTGCCTTGTCAAGG - Intronic
1129388628 15:75209344-75209366 GGGGGTGCCCTTCACTGACATGG - Intronic
1131306923 15:91253037-91253059 TAAGGGCTCCTGCACTGTCACGG - Intronic
1132796148 16:1724202-1724224 TGCGGGGCCCTGCACTCAGAAGG - Intronic
1133255049 16:4511611-4511633 TGAGGGGCCCGGCACTTACAGGG + Exonic
1133332401 16:4982597-4982619 TGAGGGGCCCTTCCCTGTGAAGG + Intronic
1135559986 16:23468832-23468854 TGGGGGCCCCTGAACTGTAAGGG - Intronic
1137250365 16:46736750-46736772 AGGGTGGCCCTGACCTGTCACGG - Intronic
1137285693 16:47014193-47014215 TGGGGGGCCCTCCTCTGGCGCGG - Intergenic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1139517563 16:67460745-67460767 TGGGTGGGCCTGCACTGGCCAGG - Intronic
1141557896 16:84848099-84848121 CGGGGGGCCATGCAGAGTCAGGG - Intronic
1142289333 16:89185566-89185588 TGGGGAGCCCTGCCCTGTGCCGG - Intronic
1143765426 17:9134647-9134669 TGGGCGGCCCTGAGCTTTCAGGG + Intronic
1145249892 17:21291594-21291616 TGGGTCCCCCTGCCCTGTCATGG + Intronic
1150388830 17:64779656-64779678 TGTGGGGGCCTCCGCTGTCAAGG + Intergenic
1152272232 17:79331409-79331431 TGGGGGGTGCATCACTGTCAGGG + Intronic
1152529669 17:80910184-80910206 CGGGGAGCCCAGCACTTTCAGGG - Intronic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1154092698 18:11379846-11379868 TGGAGGGCGCTGCACTGGCGAGG + Intergenic
1154322699 18:13367736-13367758 CCGGGGGGCATGCACTGTCAAGG + Intronic
1160884874 19:1341205-1341227 TGGGGGGCCCTGGACGGTGGTGG - Intergenic
1162328405 19:10012011-10012033 TGGGGGTCCCAGCACGGTGAGGG - Intergenic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1164210852 19:23096200-23096222 TGCTGGGCCCAGCAATGTCACGG - Intronic
1164824502 19:31274549-31274571 TTCAGGGCCCTGCACTGTCAAGG - Intergenic
1164884819 19:31769664-31769686 TGGGCTGCCCTGCACTGCCAAGG + Intergenic
1165746883 19:38234715-38234737 TGGGGGGCCATGCAGTATCAGGG + Intergenic
1165849782 19:38843071-38843093 TGGGGGGCTCTGGCCTCTCAGGG + Intronic
1166046927 19:40235322-40235344 TGGGGGGCCCAGCGATGCCAAGG - Exonic
1166674543 19:44732018-44732040 TGGTGGGCTGAGCACTGTCAGGG + Intergenic
926320277 2:11744538-11744560 TGGGGGGCCCAGCACGGCTAGGG - Intronic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
930839060 2:55825729-55825751 TGGGGGGCCCTGCCTGGTGAAGG - Intergenic
937073043 2:119079373-119079395 TGGGTGGCCATGCTCTGCCAGGG - Intergenic
937249790 2:120515979-120516001 TGTTGGGCCCTGCACTGCCGAGG + Intergenic
944466876 2:200010809-200010831 AGGTGGCCCCTGCACTTTCACGG + Intergenic
946337935 2:219050724-219050746 TGGGAGGACCTGGAGTGTCAGGG - Intergenic
948224613 2:236299194-236299216 TTCGGGGCCCCGCTCTGTCAAGG - Intergenic
948271656 2:236678514-236678536 TGGGGGTCACTGCTCTGCCAGGG - Intergenic
948428933 2:237906330-237906352 AGGGAGGCCCTGCACACTCAGGG + Intronic
948824324 2:240566990-240567012 GGTGGGGCCCTGCAGTGCCAAGG - Intronic
1169209663 20:3759048-3759070 TGGGGAGCTTTGCACTGTGAAGG - Intronic
1170566833 20:17612369-17612391 TGGGGGGCCCTGGACTGGGGAGG - Intergenic
1172173859 20:32960749-32960771 AGGGGGGCCCTGCAGGGGCATGG - Intronic
1172269854 20:33648560-33648582 TGGGGGGCCCTGCAGCTCCAGGG + Exonic
1172969349 20:38862076-38862098 TGGGGGGCCCTACACAGTTGTGG - Intronic
1173128350 20:40362085-40362107 TAGGGGGCCCTTCACTTTGAAGG - Intergenic
1174136136 20:48381390-48381412 GGGGAGACCCTTCACTGTCAGGG + Intergenic
1174295172 20:49540480-49540502 TGGGAGGGCCTGGGCTGTCAGGG + Intronic
1175108545 20:56630527-56630549 GGGGGCGCCCTGCACTGCCAAGG - Intronic
1176373883 21:6077794-6077816 TGGGGGGCCATGGTCAGTCAGGG + Intergenic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1179749594 21:43460449-43460471 TGGGGGGCCATGGTCAGTCAGGG - Intergenic
1180911824 22:19456021-19456043 TGGGTGGCCCTGCAGAGGCAGGG - Intronic
1181761177 22:25059794-25059816 AGGGGACCCCTGCACTCTCAGGG + Intronic
1183317383 22:37144149-37144171 TGGCGGCCCCTGCTCTGTCCTGG - Exonic
1183741938 22:39673661-39673683 GGGTGGGCCATGAACTGTCACGG - Intronic
1184158609 22:42684990-42685012 AGGGCTGCCCTGCAGTGTCATGG - Intergenic
1184673169 22:46026331-46026353 TGGGGAGCTCAGCTCTGTCATGG - Intergenic
1185048909 22:48543538-48543560 TGAGGTGTCCTGCTCTGTCATGG - Intronic
1185344718 22:50306239-50306261 TGGGGGGCCCACCTCTGTCCCGG - Intronic
949331621 3:2929941-2929963 TGGGGATCCCTGCCCTGGCATGG - Intronic
950442100 3:13016133-13016155 TGGGGGGCCCTGCCTGGCCATGG - Intronic
950602759 3:14049364-14049386 TGGGGGTCCCTGTACTACCAGGG + Intronic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
956110365 3:65864477-65864499 TGGGGAAGCCTGGACTGTCAAGG + Intronic
956633314 3:71337657-71337679 TTGGGGTCCCTGCTGTGTCATGG - Intronic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
965029187 3:163341488-163341510 TAGGGGGCCTTACACTTTCATGG + Intergenic
967123706 3:186406332-186406354 AGGGAGGCCCAGCACTGGCAGGG - Intergenic
968453599 4:686480-686502 CGGGGGCCCCTGCACTGTCCCGG + Intronic
968486829 4:866978-867000 TGGGGTGCTCTGCACGCTCAGGG + Exonic
968595028 4:1477806-1477828 TGATGGGCCCTGCACTGTGGAGG - Intergenic
968623915 4:1618056-1618078 TGGAGGGCCGTGCTATGTCATGG + Intronic
968634016 4:1668540-1668562 TGGGGGGCCCTGCTGGGCCAGGG - Intronic
968830576 4:2931351-2931373 TGAGTGGCCCTGCCCTGGCAGGG - Intronic
968948806 4:3679623-3679645 TGGGGGGCCCTGCTCTTCCCAGG + Intergenic
971283226 4:25259858-25259880 TGTGGGTCCCTGGACTGTCAGGG + Intronic
985377388 4:189355697-189355719 CGGGAGGCCGTGCACTGTCCTGG - Intergenic
985534329 5:455134-455156 GGGGGAGACCTGCACTGTCAAGG - Intronic
985773170 5:1825532-1825554 TGGAGCGCCCAGCACTGGCAGGG - Intergenic
986177632 5:5365374-5365396 AGAGGGGCCCAGCACTGCCATGG + Intergenic
986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG + Intronic
988581859 5:32475394-32475416 TGGGGGACCCTGCAAAGTCTGGG + Intergenic
988969286 5:36449771-36449793 GGGGAGGCCCTGCAGTGTCTGGG + Intergenic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
993211941 5:84962420-84962442 TGGGCCTCCCTGCACTCTCAGGG - Intergenic
993386592 5:87268693-87268715 TGGGGGGAGCTGGACTGACAGGG + Exonic
999282234 5:150373558-150373580 GGTGGGGCTCTGCACTGTCTTGG - Intronic
999811591 5:155132556-155132578 TGGAGGGTCCTGCAGAGTCAGGG - Intergenic
1001389389 5:171366596-171366618 TGGCGGGCCCTGCACTCACGAGG + Intergenic
1002191121 5:177478177-177478199 TGTGGGGCCCTGCACTGAGGAGG + Intergenic
1002660234 5:180786745-180786767 TGGGGGTTCCTCCACCGTCAGGG - Intergenic
1006108418 6:31730016-31730038 TGGGGGGCCCTGAACCGTGTGGG - Intronic
1012424121 6:99095618-99095640 TGGAGGGCCCTGAATTCTCAGGG + Intergenic
1013828891 6:114249483-114249505 ATGGGGACCCTGCACTGTAATGG + Intronic
1014428603 6:121339946-121339968 TGGGGGGCCCTGCACTCAGAAGG + Intergenic
1015175045 6:130296942-130296964 TGGGGTGCACTGAAGTGTCAGGG - Intronic
1017354419 6:153486371-153486393 TGGAGGGCCCTGTACATTCAAGG - Intergenic
1018028346 6:159822723-159822745 GCTGGGGCCCGGCACTGTCACGG - Intergenic
1019614759 7:1954213-1954235 TGGGGGGCCCTGCACATACCTGG - Intronic
1024348356 7:48336494-48336516 TGGTGGGCCCTGCAATTTAATGG + Intronic
1024562537 7:50656491-50656513 TGTGTGGCCCTGCAGTGACAGGG - Intronic
1025730343 7:64102237-64102259 TGGGGGGCCCTGCCCTGCCCTGG + Intronic
1026978592 7:74513684-74513706 TGAGGGGGCAGGCACTGTCATGG + Intronic
1029105364 7:98170839-98170861 TGGGGAGCCCTGCAGTGTCATGG + Intronic
1029977631 7:104849456-104849478 TGGGTGGCCCTGCACTGTGTGGG + Intronic
1032522856 7:132559518-132559540 TCAGAGGCCCTGCACTGTCTGGG + Intronic
1033261597 7:139848805-139848827 CGGGAGGCACTGCACAGTCATGG + Intronic
1034934349 7:155188972-155188994 TGGGGAGCCCTTCACTGCCTCGG - Intergenic
1035253611 7:157612888-157612910 TGGGGGGCCCTGCCCTGGCCGGG - Intronic
1035543470 8:459833-459855 TGGGGGGAGCTGGACTCTCAAGG + Intronic
1039842889 8:41306595-41306617 TGGGGGGCTCTGCCCTGAGATGG - Intronic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1047679803 8:127243002-127243024 TGTGTGGCCCTGCGGTGTCAGGG + Intergenic
1048805053 8:138232250-138232272 GGGGGAGCCCTGGACTGTCTGGG + Intronic
1049071512 8:140359111-140359133 CGGGGAGCCCTGCACTGCCGTGG - Intronic
1049473472 8:142786539-142786561 TGCGGGCCCCTGCATTGCCAAGG + Exonic
1050011171 9:1187277-1187299 AGGGGCGCCCTCCACTGCCAGGG - Intergenic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG + Intergenic
1053200405 9:36148264-36148286 TGGGGGGCCCTGCATGGTTTTGG + Intronic
1055422465 9:76158992-76159014 TGGAGCGCACTGCACTGTTAGGG - Exonic
1056101065 9:83301146-83301168 GGGGGGGCCCTGCAGTGTGCTGG + Intronic
1056911977 9:90709363-90709385 TGGAGGGCCTTGCACTGTTTTGG - Intergenic
1058444820 9:105045464-105045486 TGGGGGGCTCTGCAAGGTTATGG + Intergenic
1059525326 9:114986073-114986095 TGGGGCACCCTGCCCTGGCATGG + Intergenic
1060152006 9:121294691-121294713 TGGGGAGCACTGCTGTGTCATGG + Intronic
1062187294 9:135224711-135224733 TGGGGAGCCCCTCCCTGTCAGGG + Intergenic
1062287518 9:135779610-135779632 TGGGGGGCCCAGCATGGACAGGG + Intronic
1185431938 X:16512-16534 CGGGGGGACCTGAACTGTCGGGG - Intergenic
1185441255 X:229224-229246 CGGGGGGACCTGAACTGTCGGGG - Intergenic
1188727872 X:33607405-33607427 TGGGCAGCCCTGTACTCTCAGGG - Intergenic
1190640863 X:52482002-52482024 TGGGAGGACCTGGCCTGTCAAGG - Intergenic
1190646809 X:52530863-52530885 TGGGAGGACCTGGCCTGTCAAGG + Intergenic
1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG + Intergenic
1191066917 X:56358316-56358338 AGGGGCGCCCACCACTGTCAAGG - Intergenic
1191105541 X:56769882-56769904 TGAGCGGGCCTGCACTCTCACGG + Intergenic
1191106534 X:56775284-56775306 TGAGCGGGCCTGCACTCTCACGG + Intergenic
1191107527 X:56780686-56780708 TGAGCGGGCCTGCACTCTCACGG + Intergenic
1196458093 X:115903879-115903901 TGTGGGGCCCTGCCCTGTCCTGG + Intergenic
1196483901 X:116181890-116181912 TGGGGCTCCCTGCCCTGTCCTGG - Intergenic
1196719148 X:118837827-118837849 AGGGGGTCCCTGCATTGTAATGG - Intergenic
1200475230 Y:3634048-3634070 TGGGGGTCACTGCAAGGTCAGGG + Intergenic
1200829979 Y:7680085-7680107 TGGTGTGCGCGGCACTGTCACGG - Intergenic