ID: 1089684936

View in Genome Browser
Species Human (GRCh38)
Location 11:120140733-120140755
Sequence CTAGTCCTCCAGCGATGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 26}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089684936_1089684937 -7 Left 1089684936 11:120140733-120140755 CCAACGCATCGCTGGAGGACTAG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1089684937 11:120140749-120140771 GGACTAGTGCATGATCAAAGTGG 0: 1
1: 0
2: 0
3: 7
4: 86
1089684936_1089684939 7 Left 1089684936 11:120140733-120140755 CCAACGCATCGCTGGAGGACTAG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1089684939 11:120140763-120140785 TCAAAGTGGAAGACATAAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 295
1089684936_1089684938 6 Left 1089684936 11:120140733-120140755 CCAACGCATCGCTGGAGGACTAG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1089684938 11:120140762-120140784 ATCAAAGTGGAAGACATAAGAGG 0: 1
1: 0
2: 0
3: 22
4: 333
1089684936_1089684940 10 Left 1089684936 11:120140733-120140755 CCAACGCATCGCTGGAGGACTAG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1089684940 11:120140766-120140788 AAGTGGAAGACATAAGAGGGAGG 0: 1
1: 0
2: 2
3: 24
4: 341
1089684936_1089684941 22 Left 1089684936 11:120140733-120140755 CCAACGCATCGCTGGAGGACTAG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1089684941 11:120140778-120140800 TAAGAGGGAGGATAGAAAGATGG 0: 1
1: 0
2: 8
3: 151
4: 1222
1089684936_1089684942 29 Left 1089684936 11:120140733-120140755 CCAACGCATCGCTGGAGGACTAG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1089684942 11:120140785-120140807 GAGGATAGAAAGATGGATGCTGG 0: 1
1: 0
2: 4
3: 45
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089684936 Original CRISPR CTAGTCCTCCAGCGATGCGT TGG (reversed) Intronic
921466581 1:215494802-215494824 CTAGCCTTCCAGTGATGCATAGG + Intergenic
1069062057 10:63904658-63904680 CTACTCCTCCAGCAGTGCGGTGG - Intergenic
1083728291 11:64639886-64639908 CTGGTCCTCCAGCCAAGTGTAGG + Intronic
1089684936 11:120140733-120140755 CTAGTCCTCCAGCGATGCGTTGG - Intronic
1092160466 12:6312771-6312793 CTACTCCTCCAGTGGTGGGTAGG + Intronic
1096007202 12:48183236-48183258 CCTGTCCTCCAGCGATGCGCAGG - Intergenic
1096777547 12:53973505-53973527 CTACTCCTCCTGCTATGCGGCGG + Exonic
1116822008 14:49635111-49635133 CAAGTCCTCCAGCGACGAGGAGG + Exonic
1122294919 14:100700026-100700048 CTGGTCCTCCAGGTATTCGTTGG - Intergenic
1140127334 16:72128984-72129006 CTGGGCCTCCAGGGATGCGGAGG - Intronic
1141553314 16:84820531-84820553 CTGGTCCTCCAGACATGAGTAGG - Intronic
1141920915 16:87134740-87134762 CTGGTCCCCCAGCGATGCCATGG + Intronic
1153121759 18:1737238-1737260 CTAGTCCTCCATAAATGCATGGG - Intergenic
1158015097 18:52774718-52774740 CTAGTCCAGCAGCCATGAGTGGG - Intronic
1161077105 19:2291129-2291151 CTGGTCCTCCAGGGAGGCGATGG + Exonic
1164722618 19:30443741-30443763 CTTCTCCTCCAGGGATGCGGGGG - Exonic
1168405052 19:56106326-56106348 GTTGTCCTCCAGCGATGGGTGGG - Intronic
928429062 2:31202865-31202887 CTGGTCCTCTGGGGATGCGTGGG - Intronic
935385264 2:102492640-102492662 CTAGGCCTCCAGCCATGTGATGG + Intronic
1177893292 21:26833065-26833087 CTGGTCCTCCAGCAAAGCGTGGG - Intergenic
1180180202 21:46115523-46115545 CTGATTCTCCAGCGATGCCTGGG - Intronic
1180983358 22:19890050-19890072 CTAGCCCTCAAGCCAAGCGTGGG + Intronic
1183359181 22:37374652-37374674 CTCGTCCACCACGGATGCGTCGG - Exonic
974614768 4:64266816-64266838 CTAGACCTCCAGGCATGTGTTGG + Intergenic
981065101 4:140475425-140475447 CTAGTGCTCCAGCTATTCTTGGG - Intronic
992891023 5:81204198-81204220 CTAGTCTTCTGGCGATGCTTGGG - Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1003025658 6:2553173-2553195 CTAGTCCTTCAGAGATGTGTGGG - Intergenic
1023260510 7:38353837-38353859 CTACACCTCCAGCGTTGTGTTGG - Intergenic
1036698429 8:10994380-10994402 CAAGCCCTCCAGCGCTGCATGGG - Intronic
1060435108 9:123586382-123586404 CAAGTCCTCCAGCCAGGAGTGGG - Intronic