ID: 1089685807

View in Genome Browser
Species Human (GRCh38)
Location 11:120146082-120146104
Sequence CAGCACGAATAGATGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089685807 Original CRISPR CAGCACGAATAGATGGTACA GGG (reversed) Intronic
900338964 1:2178845-2178867 CAGCAGGAATGGATGGTGAAAGG + Intronic
903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG + Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
913281918 1:117193781-117193803 CAGCAGCAATAAATGGTACTGGG + Intronic
915510209 1:156382804-156382826 CAGCCCGAAGAGCTGGTGCATGG - Exonic
1071921045 10:90350963-90350985 GGCCAAGAATAGATGGTACATGG - Intergenic
1072950461 10:99842560-99842582 CAGCATGACTAGAGGATACATGG + Intronic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1085323972 11:75592639-75592661 GAGCAAGAATACATGGAACAGGG - Intronic
1086859627 11:91909607-91909629 CAGGAAGAATTGATAGTACAGGG - Intergenic
1086872676 11:92057663-92057685 CAGAAAGAATATCTGGTACAAGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1091722731 12:2825139-2825161 CAGCAGGAATACATTTTACATGG - Intronic
1092006258 12:5072968-5072990 CAGTAGGAATAGATTATACATGG + Intergenic
1107455921 13:40554421-40554443 GAGCACCACTAGATGATACAAGG + Intergenic
1108441024 13:50452932-50452954 CAGCACTAACAGATGTTGCAAGG - Intronic
1114784179 14:25575674-25575696 ATGCAAGAATAGATAGTACAGGG - Intergenic
1115485972 14:33911641-33911663 CAGCACCAATAAATGAGACATGG - Intergenic
1121904309 14:97725627-97725649 CAGCATGATTAGATGCTACCTGG + Intergenic
1129468213 15:75736054-75736076 AAGCAGGGTTAGATGGTACATGG - Intergenic
1129719184 15:77868613-77868635 AAGCAGGATTAGATGGTACATGG + Intergenic
1131713981 15:95088375-95088397 CAGCATGATTAGATGCTACAAGG + Intergenic
1146268723 17:31470548-31470570 AAGCAGGAATGGATGATACATGG + Intronic
1158716984 18:59889314-59889336 CAGCGAGAATAGATGGAAAAAGG + Intergenic
1159005437 18:63006114-63006136 CATCATGCAGAGATGGTACAAGG - Intergenic
925195091 2:1916467-1916489 CAGCTAGAATTGATGGTTCAGGG - Intronic
929782664 2:44967189-44967211 CAGCACTTATAGATGTTAGAGGG + Intergenic
933317479 2:80733228-80733250 AAGCAAAAATACATGGTACAGGG + Intergenic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
938056973 2:128223119-128223141 CAGAGAGAATAGATGGTAAATGG + Intergenic
940927071 2:159376071-159376093 AAGCATGAACAGAAGGTACACGG + Intronic
943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG + Intergenic
944513068 2:200483713-200483735 CAACAGGAATAGCTGATACAGGG + Intergenic
945049979 2:205814436-205814458 CAGCAACAATAGATGGCACAAGG + Intergenic
1169919639 20:10721073-10721095 CAGCAAGAACAGATTTTACAAGG - Intergenic
1170086156 20:12534693-12534715 CAGCACCTATAGATGGTATCTGG - Intergenic
1170259648 20:14389708-14389730 TAACACTAATAGATTGTACATGG - Intronic
1175254568 20:57632348-57632370 CAGAAAGAATAGATGGTAGCCGG + Intergenic
1179907812 21:44433340-44433362 CAGCACGAACAGCAGTTACAGGG + Intronic
1182395852 22:30035430-30035452 CAGCCAGAATAGATGGTCTAGGG + Intergenic
1182832616 22:33315948-33315970 GAGCAGGAAGAGATGGCACATGG - Intronic
949698512 3:6727993-6728015 CAACATGAATAAATGGTAAATGG + Intergenic
956094912 3:65706149-65706171 AACCACTAGTAGATGGTACACGG + Intronic
963171314 3:142253941-142253963 GAGCACAAATAGATGATCCAAGG + Intergenic
967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG + Intronic
975222098 4:71824304-71824326 CAGCACTAAGAGATGGTTTATGG + Intergenic
976508654 4:85881431-85881453 GAGGAAGAATAGATTGTACAGGG + Intronic
976831583 4:89320938-89320960 CTGCACAAATAGATGCTTCAGGG + Intergenic
985615929 5:922095-922117 CAGCACCAACAGAAGGTACCTGG - Intergenic
1004254468 6:14050330-14050352 CAGCATAACTAGATGGCACAAGG - Intergenic
1014561973 6:122901675-122901697 CAGCACTAAGAGATGGAGCAAGG - Intergenic
1022496596 7:30856800-30856822 CAGCATGCAGAGCTGGTACAAGG + Intronic
1024327767 7:48124608-48124630 CAGCACAAATAGATGATCTAAGG - Intergenic
1035664209 8:1368833-1368855 CATCAGGAATAGATGGTTCCAGG - Intergenic
1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG + Intronic
1040801614 8:51348287-51348309 AAGCACCAATAGATTGTTCAAGG + Intronic
1048605758 8:135967150-135967172 CAGAAAGAATAGATGGTACCTGG - Intergenic
1052364315 9:27595186-27595208 CAGGACGACTAGATGGGAGAGGG + Intergenic
1052401912 9:28011385-28011407 TAGCAAGAATAGAGAGTACAGGG + Intronic
1054726458 9:68656662-68656684 CAGTACAAATAGATGAAACAGGG + Intergenic
1055117717 9:72623670-72623692 CAGCACTAACAGCTGATACATGG - Intronic
1055880767 9:81000710-81000732 GAGCACAAATAAGTGGTACAAGG - Intergenic
1056451763 9:86723429-86723451 CAGAACCAATATGTGGTACAGGG + Intergenic
1187518701 X:19994825-19994847 CAGCACAAGTAGATGGTCCTTGG + Intergenic
1190746704 X:53327798-53327820 AAGCACGAATAGATGTTGCCAGG - Intergenic
1192298637 X:69877354-69877376 CAGTACGAAGAGATGGTAACAGG - Intronic