ID: 1089690009

View in Genome Browser
Species Human (GRCh38)
Location 11:120181283-120181305
Sequence GGTACATGAGTGAGTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089690009_1089690020 27 Left 1089690009 11:120181283-120181305 CCCAGATCACTCACTCATGTACC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1089690020 11:120181333-120181355 CACTGCACTTTGCATTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 121
1089690009_1089690018 25 Left 1089690009 11:120181283-120181305 CCCAGATCACTCACTCATGTACC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1089690018 11:120181331-120181353 AGCACTGCACTTTGCATTGCGGG 0: 1
1: 0
2: 0
3: 13
4: 150
1089690009_1089690019 26 Left 1089690009 11:120181283-120181305 CCCAGATCACTCACTCATGTACC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1089690019 11:120181332-120181354 GCACTGCACTTTGCATTGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 77
1089690009_1089690017 24 Left 1089690009 11:120181283-120181305 CCCAGATCACTCACTCATGTACC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1089690017 11:120181330-120181352 TAGCACTGCACTTTGCATTGCGG 0: 1
1: 0
2: 0
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089690009 Original CRISPR GGTACATGAGTGAGTGATCT GGG (reversed) Intronic
902213742 1:14922223-14922245 GGAACATAAATGAGTGAGCTGGG - Intronic
903135183 1:21304668-21304690 GGCACATGAGGGAATGTTCTGGG + Intronic
904353077 1:29921617-29921639 ACTACAGGAGTGAGGGATCTAGG - Intergenic
904359353 1:29961871-29961893 GGGGCATGACAGAGTGATCTAGG - Intergenic
904551892 1:31325597-31325619 GATGCATGAGTGAGTGAGCATGG - Intronic
906651230 1:47514345-47514367 GACATATGAGTGAGTCATCTTGG + Intergenic
909725211 1:78826684-78826706 GGTACAACAGTGATTTATCTAGG + Intergenic
910214492 1:84829436-84829458 GGCAGATGAGTTAGAGATCTGGG - Intronic
910728460 1:90363402-90363424 AGTACTTGAGTGATTGATTTTGG - Intergenic
910963834 1:92788043-92788065 GGTACATGAGTGAAATTTCTGGG + Intronic
913228049 1:116717802-116717824 GCTACATGGGTGGGTGAGCTTGG + Intergenic
914943820 1:152046232-152046254 GCCACATGAGTGAGCTATCTTGG + Intronic
916575411 1:166062710-166062732 GGTACGTGAGGGAGTGAAGTGGG + Intronic
917985999 1:180319401-180319423 GGTACATGAGGTACTGATATAGG + Intronic
918603580 1:186393631-186393653 GATACATAAGTGAATGATCCTGG + Intronic
919262791 1:195218945-195218967 GGTGCATAAGTGAGTGAGCTCGG - Intergenic
920008092 1:202848021-202848043 GGTACAGGGGTGAATGACCTTGG - Intergenic
921694482 1:218191915-218191937 GATACTTGACTGACTGATCTGGG + Intergenic
923793579 1:237132271-237132293 ACTACATGAGTGAGTCATCTTGG + Intronic
924388569 1:243525120-243525142 GGTTCAAGAGTCAGAGATCTGGG - Intronic
1062826660 10:574517-574539 GGTACATGTATTAGTGATCGTGG + Intronic
1065307334 10:24381526-24381548 ACTGCATGAGTGAGGGATCTAGG + Intronic
1066035842 10:31482870-31482892 GGGACAAGAGTCAGAGATCTAGG - Intronic
1068086373 10:52378187-52378209 GGTACATGAGTGTTTGAGTTCGG + Intergenic
1069561644 10:69435131-69435153 GGTGCGTGAGTGAGTGAGCATGG + Intergenic
1069612904 10:69787128-69787150 GATACTTGAGAGAGTGATGTGGG + Intergenic
1072273218 10:93797693-93797715 GACACATGTGTGAATGATCTTGG - Exonic
1072308126 10:94127947-94127969 TTTTCATAAGTGAGTGATCTAGG + Intronic
1075921385 10:126216149-126216171 GGCACATCAGTGTGTGATTTAGG - Intronic
1076309212 10:129492137-129492159 GTTTCATGAGGGATTGATCTGGG + Intronic
1076471685 10:130723519-130723541 GGTCTGTGAATGAGTGATCTGGG - Intergenic
1078874438 11:15379104-15379126 GGTACATGAGTGAGCAAGCATGG - Intergenic
1079524893 11:21374343-21374365 GCCACATGAGTGAGCCATCTTGG - Intronic
1080323345 11:31041145-31041167 GGGACAGGAGTGAAAGATCTGGG + Intronic
1081921020 11:46776614-46776636 GGCAAAACAGTGAGTGATCTGGG + Intronic
1083722191 11:64608925-64608947 GCTACATGGGTGAGAGGTCTTGG + Intronic
1088934440 11:114384868-114384890 GATATATGAGTGAGCCATCTTGG + Intergenic
1089690009 11:120181283-120181305 GGTACATGAGTGAGTGATCTGGG - Intronic
1089792306 11:120953818-120953840 GGGACCTGAGTGAGTGGCCTGGG - Intronic
1090107772 11:123870211-123870233 GGAACATGGGTGAATGATCAAGG + Intergenic
1090388885 11:126374399-126374421 GGTACAATGGTGTGTGATCTTGG - Intronic
1090578729 11:128136881-128136903 GGAACATGAGTGATTGATAATGG + Intergenic
1094075608 12:26470060-26470082 GGTATGTGAATGAGTGATCTAGG - Intronic
1094129790 12:27062774-27062796 GGTTCATTGGAGAGTGATCTGGG - Intronic
1095408190 12:41891069-41891091 TGTACAGGAGTGAGGGAGCTGGG - Intergenic
1097302218 12:58031024-58031046 GCTATATGAATGAGTCATCTTGG - Intergenic
1097342913 12:58459526-58459548 GGGACCTGAATGAGTGATTTTGG + Intergenic
1097758994 12:63438672-63438694 GGTACATGAGTTAGTTAAATAGG + Intergenic
1098903532 12:76137932-76137954 GATATATGAGTGAGTGATTTGGG - Intergenic
1100147263 12:91693076-91693098 ACTACATGAGTGAATGAGCTTGG - Intergenic
1102298760 12:111756520-111756542 GGCACATCAGTGACAGATCTGGG - Exonic
1102866677 12:116380340-116380362 GGCACATGAGTGAGACAGCTGGG - Intergenic
1105313957 13:19239668-19239690 GGCACATGACTGAGTCATCTTGG - Intergenic
1107311850 13:39086811-39086833 GGTAGATGAATGAGTTTTCTGGG - Intergenic
1107450293 13:40502363-40502385 GGTGCATGAGTGGCTGAACTGGG - Intergenic
1107830294 13:44369309-44369331 TGTACATGAGTCAGGGTTCTTGG + Intergenic
1111101870 13:83598435-83598457 GGTAAGTGAGTGAGTGAGCTGGG - Intergenic
1111237887 13:85432025-85432047 GGTATGTGAGTGAGTGACCATGG - Intergenic
1112279145 13:98047527-98047549 AGTACATGACTCATTGATCTTGG - Intergenic
1112644829 13:101318269-101318291 GGTGCATGAGTGAGTGAGCATGG + Intronic
1113195372 13:107797586-107797608 GATACATGAGTCAGTGTTCTGGG + Intronic
1113245694 13:108392527-108392549 TGTACAAGAGTTAGTGATCAAGG + Intergenic
1114191237 14:20440822-20440844 GGTACATGAGTGGGTGGTGCTGG + Intergenic
1114456401 14:22857166-22857188 GGCATATGAGTGAGCCATCTTGG + Intergenic
1114457024 14:22862107-22862129 GGCACATAAGTGAGCCATCTTGG + Intergenic
1114674494 14:24431281-24431303 GGTACATGATTGAGCCATCCTGG - Intronic
1114711140 14:24779432-24779454 GGTAATTGAGTGAGTAATCCTGG + Intergenic
1114988515 14:28261128-28261150 AGTGAATGAGTGAGTGACCTCGG + Intergenic
1118053795 14:62057166-62057188 GGCATTTGAGTGAGTGAACTGGG - Intronic
1119409732 14:74423061-74423083 GGCACATGATTGGGTGATCTTGG - Intronic
1119525889 14:75321913-75321935 GGTACATTGGTGAGGGCTCTGGG - Intergenic
1120290953 14:82569973-82569995 GGTTCATGAGTGGGTTCTCTCGG + Intergenic
1121628789 14:95407510-95407532 GGAACATGTGTGTGTTATCTCGG - Intronic
1123786931 15:23683808-23683830 GGTGCCTGTGTGAGTGAGCTTGG + Intergenic
1125213390 15:37240797-37240819 GGAACATGGGTGAATGATCAAGG + Intergenic
1130216155 15:81971942-81971964 GGTACATGAATGAGCCATCTTGG + Intergenic
1134891896 16:17848333-17848355 GATACATAAGTGAGTGAGCATGG + Intergenic
1136123121 16:28154147-28154169 GGTACATAAGTGAGTGAGGAAGG - Intronic
1139021973 16:62761035-62761057 GGTTCATAAGAGAGTGCTCTTGG - Intergenic
1141435784 16:83999035-83999057 GGTGAATGAGTGTGTGCTCTGGG - Intronic
1145967222 17:28928169-28928191 GCTATGTGAGTGAGTCATCTTGG + Intronic
1149062751 17:52442614-52442636 GTCATATAAGTGAGTGATCTGGG + Intergenic
1150974906 17:70074535-70074557 GGTAGAAAAGTGAGTGATCAGGG - Intronic
1153428692 18:4992318-4992340 AGTACATGAGTGAGTGAGTGTGG + Intergenic
1154346486 18:13547578-13547600 GGTGCATGAGTGAGTGAGCGTGG + Intronic
1160878627 19:1309551-1309573 GGCACCTGAGTGGGTGGTCTCGG + Intergenic
1163663311 19:18591228-18591250 TGTACATGAGTGTGTGTGCTTGG - Intronic
1164159988 19:22620146-22620168 GGCACAGGAGTGAGTCATCCAGG - Intergenic
1164730196 19:30497765-30497787 GGAACATGAGTGTGTGAACGTGG + Intronic
925744349 2:7031886-7031908 GGTACGTCAGTGAGTTACCTTGG + Intronic
926382587 2:12305231-12305253 AATACTAGAGTGAGTGATCTGGG + Intergenic
927819401 2:26249836-26249858 GGTACCTGAATCAATGATCTTGG + Intronic
929576545 2:43056126-43056148 GGTACATCAGTGACTGCTGTGGG - Intergenic
930013868 2:46957612-46957634 GGGACATGGGTCAGTGATGTAGG + Intronic
930743544 2:54858141-54858163 GCCACATGAGTGAGCCATCTTGG - Intronic
930754900 2:54964158-54964180 GGTACCTAAGTGGGTGGTCTGGG + Exonic
932961736 2:76420242-76420264 GGTACAAGAGGGAGGGATGTAGG + Intergenic
933833903 2:86231045-86231067 GGTTGATGAGTGAGTGACCATGG + Intronic
936794463 2:116188846-116188868 GATACATGGGTGAATGATCAAGG + Intergenic
937635364 2:124149984-124150006 GGTACAAGAGACAGAGATCTAGG - Intronic
942907584 2:181202431-181202453 GCCACATGAGTGAGACATCTTGG + Intergenic
943345506 2:186733631-186733653 GGTGCATGAGTGAGTGAGTGTGG + Intronic
943596594 2:189864830-189864852 GGTACATTAGTGACTTCTCTAGG + Intronic
947832554 2:233152023-233152045 GGTTCAAGAGTGGGTGCTCTAGG + Intronic
947947472 2:234118636-234118658 GGCATATGAGTGAGCCATCTTGG + Intergenic
948316518 2:237031534-237031556 GCCACATGAGTGAGTGACATGGG - Intergenic
948327976 2:237141694-237141716 GGAACATGAGTCAGTGGCCTTGG - Intergenic
948816747 2:240514240-240514262 GGTACATGAGAGAGAGAGCTGGG + Intronic
1169880624 20:10342373-10342395 GGTGCATGAATGAGTGAGCCTGG - Intergenic
1171014160 20:21524459-21524481 GCTACAGGAGTGGTTGATCTTGG + Intergenic
1173901471 20:46592785-46592807 GGTACCTGAGTGAGTGAAACAGG + Intronic
1174182534 20:48683862-48683884 GGTACAGGGGAGAGTGTTCTGGG + Intronic
1178102024 21:29280246-29280268 GGTACACCAGGGAGTCATCTGGG + Intronic
1178618329 21:34153209-34153231 GGTATAAGAGGGAGTGAGCTAGG - Intergenic
1179482615 21:41687991-41688013 GGTCCATGAGTGAGGGGTCCTGG + Intergenic
1179531035 21:42019888-42019910 GGTAAATGAGGGACTGCTCTGGG - Intergenic
1183279254 22:36923359-36923381 GGTGAATGAGTGAGTGATGCTGG + Exonic
949904733 3:8849701-8849723 GCTACATGAGTGACTGAGGTGGG - Intronic
951413522 3:22395188-22395210 GGTACATGAATGAGCAATGTAGG - Intergenic
952305354 3:32140836-32140858 TCTACATTAGTGTGTGATCTTGG - Intronic
959476914 3:106822454-106822476 GGTGCATGAGTGAGTGAGTGTGG - Intergenic
961046647 3:123713092-123713114 AGGAGATGAGTGAGTGAACTTGG + Intronic
962952210 3:140229631-140229653 GGTACCTGAGTGAGTGAAGGAGG + Intronic
965118491 3:164521328-164521350 GGTATATGAGTGAGTGATTGTGG + Intergenic
965353260 3:167642257-167642279 GGTACATGGGTTAGAGAACTGGG - Intronic
969059639 4:4424697-4424719 GGTGCATGTGTGAGTGACCAAGG + Intronic
970541562 4:17085610-17085632 GGTATGTGAGCGAGTCATCTGGG + Intergenic
971893014 4:32550025-32550047 GGTACATGAGTGAATAATAACGG + Intergenic
975812581 4:78184335-78184357 TGTAAATGAATGAGTGAGCTGGG + Intronic
977758186 4:100698635-100698657 TATACATGAGTGTGTGATCTTGG + Intronic
979267120 4:118716550-118716572 GGAAAATGAGTGAGTGGTCTGGG - Intergenic
981785087 4:148468484-148468506 GGTTCTTTAGTGAGTGATTTTGG + Intergenic
982940532 4:161547159-161547181 GCCACGTGAGTGAGTAATCTTGG + Intronic
983125730 4:163949158-163949180 GGTATGTGAGTGAGTGAGCATGG + Intronic
985386750 4:189455168-189455190 GGCTCATGAGTGAGCCATCTCGG + Intergenic
985981161 5:3465118-3465140 GCTTTATGAGTGAGTGAACTTGG - Intergenic
986890194 5:12294627-12294649 GGTAGATTAGTGAGGGATTTAGG - Intergenic
990493917 5:56327613-56327635 TGTAGATGAGTGAGTGCCCTTGG - Intergenic
991622847 5:68563830-68563852 GACACATGAGTGAGCCATCTTGG + Intergenic
992632956 5:78699647-78699669 GGTACATTAGGGTGTGATGTGGG + Intronic
994502346 5:100595640-100595662 GCCACAAGAGTGAGTCATCTTGG - Intergenic
995724126 5:115166958-115166980 GGTGCATGAGTGAGCGAGCGCGG - Intronic
997280580 5:132641632-132641654 GGGACCTGAGTGGGTGTTCTGGG - Intronic
998609886 5:143676721-143676743 TGTGCATGAGTGACTGATATAGG - Intergenic
998804103 5:145901687-145901709 AGTAGATGAGGGAGGGATCTAGG + Intergenic
1000991441 5:167915886-167915908 GGTATATGAGTGAGAAATGTGGG + Intronic
1003664568 6:8098740-8098762 GTTACCTGAGTGTGTGAACTTGG + Intronic
1005911506 6:30313955-30313977 GGCACATGAGTGAGCTACCTTGG + Intergenic
1008395003 6:50995836-50995858 TGTAAATGACTGAGTGAGCTGGG + Intergenic
1011262789 6:85486082-85486104 GGTACGTTAGTGAGGGATTTAGG + Intronic
1011621524 6:89248309-89248331 ACTACATGAGTCAGTAATCTGGG - Intergenic
1012502217 6:99901147-99901169 GGCACATGAGTGAGGGTCCTGGG - Intergenic
1015753645 6:136586512-136586534 GGCACATGAGTGAGTTAACATGG - Intronic
1016282603 6:142435574-142435596 ACTACATGATTGATTGATCTTGG + Intronic
1023547343 7:41331876-41331898 TGTCCAGGAGTTAGTGATCTAGG + Intergenic
1025040758 7:55643038-55643060 GTTACATCAGTGAGTGAACGTGG + Intergenic
1025991442 7:66500250-66500272 GTCACATGAGTGAGCCATCTTGG - Intergenic
1028258153 7:88626698-88626720 GGTGGATAAGTGAGTGATCATGG + Intergenic
1029036279 7:97525778-97525800 GGAAGATGACTGTGTGATCTTGG + Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1032734283 7:134676683-134676705 AGAACATGTGTGAGTGACCTTGG - Intronic
1033848160 7:145460928-145460950 AATACATGAGTGAGTGTGCTGGG - Intergenic
1034540470 7:151754991-151755013 TGTACATCAGGGAGTGCTCTTGG + Intronic
1035245034 7:157557440-157557462 GGTGTATGAGTGTGTGATATGGG - Intronic
1036689905 8:10938714-10938736 GGCACATGGGAGAGTGTTCTGGG + Intronic
1038017692 8:23529173-23529195 GGTACATGACCGAGTGCTCCAGG - Exonic
1041157058 8:54998447-54998469 GGTGCACCAGTGAGAGATCTCGG - Intergenic
1042801851 8:72727239-72727261 GGCAAATGAGTGAGTGTACTGGG - Intronic
1043243314 8:77964535-77964557 GCCACATGTGTGAGTGCTCTTGG + Intergenic
1044225592 8:89714406-89714428 GTTACGTGAGTGAGCCATCTTGG - Intergenic
1044614005 8:94120704-94120726 GGTGTATGAGTGAGCGATCGTGG - Intergenic
1045440256 8:102201874-102201896 AGTAGATGAGTGAGAGAACTTGG - Intergenic
1047609379 8:126506014-126506036 GGCACATGAGTGTGTGACATAGG - Intergenic
1047942840 8:129842718-129842740 GATACATGAATGAGTCAACTTGG - Intronic
1048975590 8:139671270-139671292 GGTGCATCAGTGAGTGATGGGGG - Intronic
1049132745 8:140862736-140862758 GGTGCACGTGTGAGGGATCTAGG + Intronic
1052367655 9:27631223-27631245 GGTACATGAGTCAGAGAACAGGG + Intergenic
1053111835 9:35467634-35467656 TGTGCATCAGTGAGAGATCTTGG - Intergenic
1060103892 9:120861807-120861829 GGGACATGAGAGAGTCCTCTGGG + Intronic
1188020592 X:25152662-25152684 GATAGATGAATGAGTGATTTGGG + Intergenic
1188633108 X:32392907-32392929 GGCATGTGAATGAGTGATCTTGG + Intronic
1189928417 X:45982203-45982225 GCTATATGAGTGAGCCATCTTGG + Intergenic
1192267325 X:69547704-69547726 GGTATGTGAGTGAGTGAGCATGG - Intergenic
1195665673 X:107428050-107428072 TGTACATGAGTCAGGAATCTTGG + Intergenic
1198493944 X:137171514-137171536 GGTAGATGAGTAAGAAATCTAGG + Intergenic
1199726584 X:150588954-150588976 GTTAAATGAGTGAATGAACTGGG - Intronic