ID: 1089690016

View in Genome Browser
Species Human (GRCh38)
Location 11:120181327-120181349
Sequence CAATGCAAAGTGCAGTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089690016_1089690021 5 Left 1089690016 11:120181327-120181349 CCATAGCACTGCACTTTGCATTG 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1089690021 11:120181355-120181377 GCACCATAGAACTACAGACACGG 0: 1
1: 0
2: 0
3: 25
4: 904
1089690016_1089690023 20 Left 1089690016 11:120181327-120181349 CCATAGCACTGCACTTTGCATTG 0: 1
1: 0
2: 0
3: 13
4: 141
Right 1089690023 11:120181370-120181392 AGACACGGTCTTCGCCTTCAAGG 0: 1
1: 0
2: 7
3: 44
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089690016 Original CRISPR CAATGCAAAGTGCAGTGCTA TGG (reversed) Intronic
900137114 1:1122307-1122329 CAACGCCAAGTGCAGTGCCCAGG - Intergenic
907109879 1:51917478-51917500 CAATGCAGAGAGCAGAGCTTTGG - Exonic
910570049 1:88689810-88689832 CAAAGAAAAGTGCAGTAGTATGG + Intronic
911131360 1:94391622-94391644 CAATGAGGAGTGCAGTGCTAAGG - Intergenic
912137694 1:106681859-106681881 CAATGCCATCTGCAGTGCCATGG - Intergenic
914760926 1:150597643-150597665 AAATGCAAAGTTCAGTGCAAAGG + Intergenic
915244310 1:154545351-154545373 CAGTGCTAAGTGCTGTGCTCTGG - Intronic
915644942 1:157263602-157263624 CAATGTAAAGTTCAGTGTGATGG - Intergenic
916472155 1:165134652-165134674 CAGTGGAAAGAGCAGTGCTTTGG + Intergenic
916912271 1:169363743-169363765 TAATACAAAGTGCAGTGATCTGG - Intronic
917735942 1:177920623-177920645 CCATGGAAAGTGCAGTTCTTAGG + Intergenic
918566078 1:185933816-185933838 CAGTGCAAGGTACAGTGCTTTGG + Exonic
918682030 1:187367765-187367787 CACTGCAAAGTACACTGCTGTGG - Intergenic
920163432 1:204017577-204017599 CAAGGAGAAGTGCAGAGCTAAGG - Intergenic
921041995 1:211441577-211441599 CAATGTAAAATGCATTTCTATGG + Intergenic
923144526 1:231188561-231188583 ACATCCAAAGTGCAGTGCAATGG + Intronic
1064385193 10:14884262-14884284 AAATGTAAAATGCAGTGCTTTGG - Intronic
1069883060 10:71606019-71606041 CCATGCACAGTGCATTGCTGTGG + Intronic
1071080304 10:81802540-81802562 CAATGCAGATTCCAGGGCTATGG + Intergenic
1072766128 10:98096531-98096553 CAGTGGAAACTGCAGTGCTTTGG + Intergenic
1075399247 10:122149692-122149714 CAAGGCAAAGTGCCGCGCTGGGG - Intronic
1076536644 10:131182248-131182270 CAATGCAAAATGCATTTTTACGG - Intronic
1076999390 11:315134-315156 CATTGCACAGTGGAGTGCAAAGG - Exonic
1078659371 11:13274838-13274860 CAATTCATAGGGCACTGCTAAGG - Intergenic
1079254120 11:18811823-18811845 CAAAGCAAAGTGCTATGTTATGG - Intergenic
1079976811 11:27102172-27102194 AAAAGCAAAGTACAGTGCTAAGG + Intronic
1087069307 11:94061250-94061272 CAGTGTAAAGTGCAGAGGTAAGG + Intronic
1089690016 11:120181327-120181349 CAATGCAAAGTGCAGTGCTATGG - Intronic
1090216506 11:124970550-124970572 CAATGTAAAGTGTATTGTTAAGG - Intronic
1091666299 12:2420768-2420790 CAATGCAAGGCGCAGAGCCAGGG - Intronic
1095608820 12:44102922-44102944 CAAGGAAAAGTGCAGAGCAAAGG - Intronic
1095817067 12:46435316-46435338 CTATGCAATGTGGAATGCTATGG + Intergenic
1095919838 12:47518056-47518078 AAATGCAGAGTGAAGTGGTAAGG + Intergenic
1096600608 12:52726016-52726038 CCATGCAAAGTGCCCTTCTAAGG - Intergenic
1098090806 12:66899056-66899078 AAATGCAAAGAGAAGCGCTAGGG - Intergenic
1099925355 12:89010117-89010139 CCATGCAGAGTGCAGTGCCCTGG + Intergenic
1100784315 12:98063057-98063079 CACTGCAGAGGGCAGTGCTCTGG - Intergenic
1102747259 12:115260010-115260032 AAACTCATAGTGCAGTGCTATGG + Intergenic
1103972179 12:124679175-124679197 CATTGCAGAGTACAGTGCAATGG + Intergenic
1106139184 13:26997332-26997354 CTGTGCAAGGTGCAGAGCTAAGG - Intergenic
1106558602 13:30830590-30830612 CAATGGGTAGTGCAGTGCTCTGG + Intergenic
1107576965 13:41734765-41734787 CTTTGTAAAGTGTAGTGCTAGGG - Intronic
1111325564 13:86692199-86692221 CACGGCAACCTGCAGTGCTATGG - Intergenic
1116149178 14:41116662-41116684 CAATGCAAGCTTAAGTGCTACGG + Intergenic
1117518530 14:56527095-56527117 GACTGCAAACTGCAGAGCTAAGG - Intronic
1118010165 14:61602615-61602637 CATTGCAAAATGCAGTGCAAAGG + Intronic
1118286334 14:64477268-64477290 CAATGCACAACACAGTGCTAGGG - Intronic
1119638131 14:76293249-76293271 GAATGCATAGTGCAGGGCCAGGG - Intergenic
1120039931 14:79740683-79740705 AAATGCAAAGTCCAGTGGAAAGG - Intronic
1121271961 14:92643585-92643607 CAATGCCAAGTGCTCTGCAATGG - Intronic
1122231599 14:100308877-100308899 CCTTGCAAAGTGCACAGCTAAGG - Intergenic
1123724802 15:23091365-23091387 CAATGATAAGTGAAGTTCTAGGG - Intergenic
1123833861 15:24168483-24168505 CAACGCAGAGGCCAGTGCTAAGG + Intergenic
1123840600 15:24243531-24243553 CAACGCAGAGGCCAGTGCTAAGG + Intergenic
1123853547 15:24384046-24384068 CAACGCAGAGGCCAGTGCTAAGG + Intergenic
1123869517 15:24556651-24556673 CAATGCAGAGGCCAATGCTAAGG + Intergenic
1128564277 15:68689867-68689889 CACTGCAAAGTGATGTGCTGGGG + Intronic
1130416205 15:83696916-83696938 CAATCCAGAGTGCAGTGACATGG + Intronic
1130846518 15:87752670-87752692 CCATGCAAAGTGCAGGGGTAGGG + Intergenic
1131758166 15:95588802-95588824 CAATGCACAGTGCAGTGAGTGGG + Intergenic
1133523277 16:6579553-6579575 CAAGGAAAAGTGCAGAGCAAAGG - Intronic
1135478647 16:22801868-22801890 CACAGAAAAGTGCAGGGCTAAGG - Intergenic
1136360518 16:29776364-29776386 CAATGGGAAGTGCAAAGCTAAGG - Intergenic
1138770805 16:59661313-59661335 CAAGGAAAAGTGCAGAGCGATGG + Intergenic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1144220183 17:13092673-13092695 AAATGCAATGGGAAGTGCTATGG + Intergenic
1145209140 17:21000334-21000356 TAATGCAAGGGGCAGTGCCAGGG + Exonic
1147136910 17:38439492-38439514 CAATGCAGTGTCAAGTGCTATGG - Intronic
1147357086 17:39906560-39906582 CCATTCAAAGTGCAGTCCTCAGG + Intronic
1150820554 17:68431012-68431034 CTATGCTAGGTGCACTGCTAGGG + Intronic
1158125897 18:54099635-54099657 CAATGCAGAGAGCAGGGCTCTGG - Intergenic
1164917023 19:32060033-32060055 AAATGCAAAGTGTAGTGCGGAGG + Intergenic
1166850593 19:45758806-45758828 CAATGCCAGCTGCTGTGCTAGGG + Intronic
925456557 2:4021360-4021382 CAATGCCAAGTGCTGTCCTCAGG - Intergenic
926406158 2:12555094-12555116 CAGGGCAATGAGCAGTGCTAGGG - Intergenic
927589633 2:24342500-24342522 CAGTCCAAAGGGCAGAGCTAAGG + Intronic
927852068 2:26505718-26505740 CACAGAAAAGTGCAGTCCTACGG - Intronic
930521521 2:52473382-52473404 CACTCCAAAGTGCAGTGCTGTGG + Intergenic
934495991 2:94799700-94799722 CCAGGCAAAGTGCAGTGATGTGG - Intergenic
937431693 2:121844108-121844130 CAATTGAAGGTGCAGTGCTGGGG - Intergenic
938368055 2:130750990-130751012 CAATGCCAAGTACAGTGCCTCGG + Intergenic
939322857 2:140647329-140647351 CAATTTGAAGTGCAGTGCAATGG - Intronic
942631217 2:177951679-177951701 TCATGCAATGGGCAGTGCTATGG + Intronic
946126978 2:217571405-217571427 CAATGCTAAGAGCAGTGCCCTGG + Intronic
946133937 2:217629903-217629925 TACTGAAAAGTGCAGTCCTAAGG - Intronic
946236007 2:218324605-218324627 TAATGCAACGTGCAGAGCAATGG - Intronic
946625230 2:221604496-221604518 CAATGGAAATTGCTGTGGTAAGG + Intergenic
1169847935 20:10015696-10015718 CAAAGGAAAGTGCTGTGTTAAGG - Intronic
1170849850 20:19994925-19994947 CAATGGAAAGTGCATGGCTCAGG + Intronic
1172627807 20:36358230-36358252 AAATGCAAACTGCAGTGCGGTGG + Intronic
1172834293 20:37863162-37863184 CAGTGCTAAGTGCTGTGCTATGG + Intronic
1173785325 20:45789005-45789027 CCATGCAAAGAGCTGTGCCAGGG - Exonic
1176265151 20:64205390-64205412 AAAAGCAAAGTGCAGCACTAGGG - Intronic
1181463306 22:23097786-23097808 CAAGGCAAAGTGAGGTGCTCAGG + Intronic
1181545600 22:23600383-23600405 AAATGCTAGGTGCAGAGCTATGG - Intergenic
1181814707 22:25429516-25429538 AAATGCTAGGTGCAGAGCTATGG + Intergenic
952599628 3:35064745-35064767 CACTGTAAAGTGAAGTGCTGAGG - Intergenic
962796552 3:138854561-138854583 CAATGCAAAATGCATTCTTACGG - Intergenic
964628954 3:158788402-158788424 CAATGCCAAGGCCAGTCCTATGG + Intronic
965082274 3:164049809-164049831 CAATAGAAAGTGAACTGCTATGG + Intergenic
967275836 3:187773758-187773780 TAATGCAAGGCACAGTGCTAAGG - Intergenic
967700081 3:192582110-192582132 AAATGCAAAGTGTAATGCAACGG - Intronic
970118486 4:12726038-12726060 TAATGCAATGTGCAATGTTAAGG - Intergenic
970445416 4:16120084-16120106 CCAGGCAAAGTACAGTGCAAAGG + Intergenic
970899259 4:21139652-21139674 CAATTCCAGGGGCAGTGCTAAGG - Intronic
972268644 4:37487429-37487451 CAATGCATATTGAAGTGCTGGGG - Intronic
974930894 4:68359790-68359812 CACTGCAAAGGCCAGTGCTAGGG - Intergenic
975172885 4:71252985-71253007 CACTGCACTGTGAAGTGCTATGG - Intronic
977299677 4:95253753-95253775 CAAAGCAGAGTGCTGTGATATGG - Intronic
979292149 4:118990285-118990307 CAAAGAAACGTGCAGTGCTGTGG + Intronic
980261344 4:130452569-130452591 CAATGGAAAGAGTAGTGATATGG + Intergenic
984769447 4:183424563-183424585 AAATGCAAAGTGCACTCCTAGGG + Intergenic
990954025 5:61326085-61326107 CAATGCAAAGTGCAATGGTGAGG - Intergenic
994969752 5:106720136-106720158 CAATGCAAAATGCAGTGTCTTGG + Intergenic
995241889 5:109894537-109894559 CACTGAAATGTGCAATGCTATGG + Intergenic
995810369 5:116100381-116100403 CATTGCAAAGGCCAGTGCTAAGG + Intronic
996310557 5:122099328-122099350 CAGTGTAGAGGGCAGTGCTAGGG + Intergenic
999057696 5:148597609-148597631 CAGTGAAAAGAGCAGTGCAAAGG - Intronic
999457687 5:151731508-151731530 CAGGCCAAAGTGCAGTGCTGAGG - Intergenic
999538025 5:152539852-152539874 CAAGCCAACGTGCAGTACTAAGG - Intergenic
1000755031 5:165147660-165147682 CAATGCAGAGTGGAGTGGTGGGG - Intergenic
1003023537 6:2532555-2532577 CATTGCCAAGAGCAATGCTAAGG + Intergenic
1006487070 6:34351841-34351863 CAGTGCAATTGGCAGTGCTAAGG + Intronic
1007376250 6:41458668-41458690 AAATGCAAAGTGCAGTGACATGG - Intergenic
1009527055 6:64760738-64760760 CAGTGCAAAGTGCATTCATAAGG + Intronic
1014692269 6:124576698-124576720 CAATGAAAAGTTCACTGATAGGG + Intronic
1021811182 7:24402338-24402360 CAATTCAAACTACAGTTCTAAGG - Intergenic
1022853817 7:34295974-34295996 CAATGTTAAGTGAAGAGCTATGG + Intergenic
1024041386 7:45558737-45558759 CAATGCATACTGAAGTGCTCAGG - Intergenic
1024722712 7:52155841-52155863 CAATGCAAGGCTCAGTGCTGTGG - Intergenic
1026231699 7:68489510-68489532 AAGTGCAAAGTGCACTGGTATGG - Intergenic
1027867758 7:83669465-83669487 CAATGAAAAATGCAGAACTATGG + Intergenic
1031697893 7:124882904-124882926 AAATACAAAGTGAAGTGATAGGG + Intronic
1032808223 7:135379942-135379964 AAATGCTAAGTGCAGTCCTTGGG + Intronic
1035023677 7:155813307-155813329 CAGAGCAAAGTGCAGAGCCAGGG + Intergenic
1044917677 8:97132946-97132968 CAATTCAAAATACAGTGGTAAGG + Intronic
1046592716 8:116225385-116225407 CAATGCAAAATGGAGAGCTGGGG + Intergenic
1046872655 8:119220732-119220754 CAATCCAAAGCACAGGGCTATGG - Intronic
1048523105 8:135175625-135175647 CAATGCAAATTAAAATGCTAAGG + Intergenic
1051714994 9:19973229-19973251 CACTGCAATGTGCAATGCCATGG + Intergenic
1052392090 9:27892189-27892211 CAATTCAAACTACAGTGCTTGGG - Intergenic
1055127697 9:72738121-72738143 CAATGCAATGGTCAATGCTATGG + Intronic
1055900427 9:81227917-81227939 CACAGCAAAGTGCAGTATTAAGG + Intergenic
1059859376 9:118441491-118441513 AGATGCAAAGAGCAGTGTTAGGG - Intergenic
1060216182 9:121739833-121739855 CAAAGGAAAGTGTTGTGCTAAGG + Intronic
1061475162 9:130860493-130860515 CACTCCAAAGTGGAATGCTAAGG - Intronic
1062277853 9:135739144-135739166 CCCTGCCCAGTGCAGTGCTAGGG - Intronic
1185647933 X:1628394-1628416 CAAAGCAAAGTGAAGAGCTGAGG - Intronic
1190292383 X:49001392-49001414 CCATTCATAGTGCAATGCTATGG + Intronic
1190636334 X:52437756-52437778 CAATTCAAAGTACAAAGCTATGG - Intergenic
1190638114 X:52456258-52456280 GAATGCTGAGTTCAGTGCTAGGG + Intergenic
1196695251 X:118604467-118604489 CAATTCAATGTGTAGTGCTAGGG - Intronic
1196702645 X:118688217-118688239 CAGTGCATATTGCTGTGCTAGGG - Intergenic
1199620726 X:149697906-149697928 GAAAGAAAAGTGCAGTGCGAAGG - Intronic
1201896313 Y:18996463-18996485 CAAAGCTAAATGCAGAGCTAAGG + Intergenic