ID: 1089691658

View in Genome Browser
Species Human (GRCh38)
Location 11:120190643-120190665
Sequence CCCTAGGCCCAGGGGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089691658_1089691668 5 Left 1089691658 11:120190643-120190665 CCCTTCAGCCCCTGGGCCTAGGG No data
Right 1089691668 11:120190671-120190693 AGCTCTGGGCCTTCACGGAGAGG No data
1089691658_1089691667 0 Left 1089691658 11:120190643-120190665 CCCTTCAGCCCCTGGGCCTAGGG No data
Right 1089691667 11:120190666-120190688 CTGAAAGCTCTGGGCCTTCACGG No data
1089691658_1089691665 -9 Left 1089691658 11:120190643-120190665 CCCTTCAGCCCCTGGGCCTAGGG No data
Right 1089691665 11:120190657-120190679 GGCCTAGGGCTGAAAGCTCTGGG No data
1089691658_1089691664 -10 Left 1089691658 11:120190643-120190665 CCCTTCAGCCCCTGGGCCTAGGG No data
Right 1089691664 11:120190656-120190678 GGGCCTAGGGCTGAAAGCTCTGG No data
1089691658_1089691670 27 Left 1089691658 11:120190643-120190665 CCCTTCAGCCCCTGGGCCTAGGG No data
Right 1089691670 11:120190693-120190715 GTCCACTGTCTGCAGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089691658 Original CRISPR CCCTAGGCCCAGGGGCTGAA GGG (reversed) Intergenic
No off target data available for this crispr