ID: 1089692905

View in Genome Browser
Species Human (GRCh38)
Location 11:120197843-120197865
Sequence CTGTTGCTCAGGATCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089692905_1089692915 11 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692915 11:120197877-120197899 AATCAGGGCAAGGCGGTGGGTGG No data
1089692905_1089692924 24 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692924 11:120197890-120197912 CGGTGGGTGGGGGGTGGGGGAGG No data
1089692905_1089692908 -5 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692908 11:120197861-120197883 AACAGACAACACCGAGAATCAGG No data
1089692905_1089692911 4 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692911 11:120197870-120197892 CACCGAGAATCAGGGCAAGGCGG No data
1089692905_1089692913 7 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692913 11:120197873-120197895 CGAGAATCAGGGCAAGGCGGTGG No data
1089692905_1089692920 18 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692920 11:120197884-120197906 GCAAGGCGGTGGGTGGGGGGTGG No data
1089692905_1089692918 14 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692918 11:120197880-120197902 CAGGGCAAGGCGGTGGGTGGGGG No data
1089692905_1089692922 20 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692922 11:120197886-120197908 AAGGCGGTGGGTGGGGGGTGGGG No data
1089692905_1089692914 8 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692914 11:120197874-120197896 GAGAATCAGGGCAAGGCGGTGGG No data
1089692905_1089692916 12 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692916 11:120197878-120197900 ATCAGGGCAAGGCGGTGGGTGGG No data
1089692905_1089692923 21 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692923 11:120197887-120197909 AGGCGGTGGGTGGGGGGTGGGGG No data
1089692905_1089692921 19 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692921 11:120197885-120197907 CAAGGCGGTGGGTGGGGGGTGGG No data
1089692905_1089692909 -4 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692909 11:120197862-120197884 ACAGACAACACCGAGAATCAGGG No data
1089692905_1089692919 15 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692919 11:120197881-120197903 AGGGCAAGGCGGTGGGTGGGGGG No data
1089692905_1089692910 1 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692910 11:120197867-120197889 CAACACCGAGAATCAGGGCAAGG No data
1089692905_1089692917 13 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692917 11:120197879-120197901 TCAGGGCAAGGCGGTGGGTGGGG No data
1089692905_1089692925 29 Left 1089692905 11:120197843-120197865 CCCTGGTGGATCCTGAGCAACAG No data
Right 1089692925 11:120197895-120197917 GGTGGGGGGTGGGGGAGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089692905 Original CRISPR CTGTTGCTCAGGATCCACCA GGG (reversed) Intergenic
No off target data available for this crispr