ID: 1089693536

View in Genome Browser
Species Human (GRCh38)
Location 11:120201501-120201523
Sequence TATCCCCTCTTTAACGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089693531_1089693536 8 Left 1089693531 11:120201470-120201492 CCGCATCATAACCAACTGGAGTA No data
Right 1089693536 11:120201501-120201523 TATCCCCTCTTTAACGTGGGAGG No data
1089693533_1089693536 -3 Left 1089693533 11:120201481-120201503 CCAACTGGAGTAGGTACTAATAT No data
Right 1089693536 11:120201501-120201523 TATCCCCTCTTTAACGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089693536 Original CRISPR TATCCCCTCTTTAACGTGGG AGG Intergenic
No off target data available for this crispr