ID: 1089693935

View in Genome Browser
Species Human (GRCh38)
Location 11:120204713-120204735
Sequence TAGCCCTGTGTACCTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089693935_1089693938 25 Left 1089693935 11:120204713-120204735 CCAGTGCCAGGTACACAGGGCTA No data
Right 1089693938 11:120204761-120204783 CTGCATACAAAGCACCATGCTGG No data
1089693935_1089693939 26 Left 1089693935 11:120204713-120204735 CCAGTGCCAGGTACACAGGGCTA No data
Right 1089693939 11:120204762-120204784 TGCATACAAAGCACCATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089693935 Original CRISPR TAGCCCTGTGTACCTGGCAC TGG (reversed) Intergenic
No off target data available for this crispr