ID: 1089694745

View in Genome Browser
Species Human (GRCh38)
Location 11:120210328-120210350
Sequence CCGGGTCTGCGGTGGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089694733_1089694745 30 Left 1089694733 11:120210275-120210297 CCTGGAATCCAACATTTCCCTGG No data
Right 1089694745 11:120210328-120210350 CCGGGTCTGCGGTGGTGGGCAGG No data
1089694736_1089694745 13 Left 1089694736 11:120210292-120210314 CCCTGGATTTTCATAGTCTATAA No data
Right 1089694745 11:120210328-120210350 CCGGGTCTGCGGTGGTGGGCAGG No data
1089694737_1089694745 12 Left 1089694737 11:120210293-120210315 CCTGGATTTTCATAGTCTATAAT No data
Right 1089694745 11:120210328-120210350 CCGGGTCTGCGGTGGTGGGCAGG No data
1089694735_1089694745 22 Left 1089694735 11:120210283-120210305 CCAACATTTCCCTGGATTTTCAT No data
Right 1089694745 11:120210328-120210350 CCGGGTCTGCGGTGGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089694745 Original CRISPR CCGGGTCTGCGGTGGTGGGC AGG Intergenic
No off target data available for this crispr