ID: 1089694919

View in Genome Browser
Species Human (GRCh38)
Location 11:120211071-120211093
Sequence CGTCTCCGCCTCGGGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089694913_1089694919 -6 Left 1089694913 11:120211054-120211076 CCGGGCCGGGGCAGCGCCGTCTC 0: 1
1: 0
2: 2
3: 27
4: 235
Right 1089694919 11:120211071-120211093 CGTCTCCGCCTCGGGGCCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 160
1089694907_1089694919 9 Left 1089694907 11:120211039-120211061 CCCGGGGCCGCGGAGCCGGGCCG 0: 1
1: 0
2: 5
3: 48
4: 436
Right 1089694919 11:120211071-120211093 CGTCTCCGCCTCGGGGCCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 160
1089694912_1089694919 2 Left 1089694912 11:120211046-120211068 CCGCGGAGCCGGGCCGGGGCAGC 0: 1
1: 0
2: 3
3: 49
4: 351
Right 1089694919 11:120211071-120211093 CGTCTCCGCCTCGGGGCCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 160
1089694908_1089694919 8 Left 1089694908 11:120211040-120211062 CCGGGGCCGCGGAGCCGGGCCGG 0: 1
1: 0
2: 6
3: 60
4: 473
Right 1089694919 11:120211071-120211093 CGTCTCCGCCTCGGGGCCGCCGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089694919 Original CRISPR CGTCTCCGCCTCGGGGCCGC CGG Exonic
900102557 1:968063-968085 CAGCTCAGCCTCGGGGCCCCGGG - Intronic
900390034 1:2429789-2429811 TGGCTCCTCCTCGGGGCCGTGGG + Intronic
900580174 1:3404906-3404928 CGTCTCAGCCCCGGGGCAGCAGG + Intronic
901066646 1:6497464-6497486 CGGCCCCGCCTCGGGGGCGGGGG + Intronic
903180186 1:21601436-21601458 GGTCCCCGCCTCACGGCCGCAGG - Intronic
903925218 1:26826890-26826912 CGTCCCCGACTCCGGGCCCCGGG + Exonic
903986930 1:27235074-27235096 CCTACCCGCCTCGGGGCCCCGGG + Intronic
904344029 1:29856478-29856500 CATCTCCGCCTCTGAGCCCCAGG + Intergenic
907412140 1:54290362-54290384 TGTCTCTGGCTCTGGGCCGCCGG - Intronic
910183168 1:84506720-84506742 GCTCTCCGCCTCGGGTCAGCGGG - Intergenic
912345912 1:108963268-108963290 CGTCTGCGCCGCGAGTCCGCTGG + Intronic
913205486 1:116534506-116534528 CGCCTCCTCCGCTGGGCCGCCGG + Intronic
913959356 1:143327160-143327182 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
913959368 1:143327204-143327226 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
913959380 1:143327248-143327270 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914053674 1:144152540-144152562 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914053686 1:144152584-144152606 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
914125433 1:144813675-144813697 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125445 1:144813719-144813741 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125457 1:144813763-144813785 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125511 1:144813957-144813979 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
914125523 1:144814001-144814023 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
916660845 1:166921255-166921277 CGTCTGCCCGGCGGGGCCGCTGG + Exonic
1062981338 10:1725467-1725489 CGTCTCTTCCTCTGGGCTGCAGG - Intronic
1063568418 10:7192798-7192820 CGTCTCTGACTCAGGGCCGGGGG + Intronic
1064443102 10:15371050-15371072 CATCTCCGCCGCGGGGCCGGCGG + Exonic
1064981938 10:21174063-21174085 CGGCTCCGGCTCCGCGCCGCTGG + Intronic
1068309890 10:55263517-55263539 CCTCTCCCCCTCGTGGCTGCTGG - Intronic
1072408982 10:95183546-95183568 CCTCGCCTCCTCCGGGCCGCGGG + Intergenic
1075082216 10:119391626-119391648 CGTCCCCGCCTGGGCACCGCAGG - Intronic
1076329147 10:129652287-129652309 CGTCTCCGCTCGGGGGCTGCTGG - Intronic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1077035522 11:492597-492619 CGGGTCTGCCTCGGGGCCCCGGG + Intergenic
1077114111 11:875357-875379 CGTCTCCCGCTCGGGGAGGCGGG + Intronic
1077204936 11:1337494-1337516 CGCCCCCGCCTCGGGCCCCCGGG - Intergenic
1077533311 11:3107303-3107325 CCTCTCCGCACCGGGGCCCCAGG + Exonic
1081938705 11:46922445-46922467 AGTCTCTGCCTCTGGGCCCCAGG + Intergenic
1089694919 11:120211071-120211093 CGTCTCCGCCTCGGGGCCGCCGG + Exonic
1089732374 11:120527284-120527306 CATCTCCACCCTGGGGCCGCAGG - Intronic
1097664918 12:62467218-62467240 CTTCACCGCCTCGGGGCTGCTGG - Exonic
1098898067 12:76084867-76084889 CGCCTGGGCCTCGGGGCTGCAGG - Exonic
1103563599 12:121804679-121804701 CGTCTCCGCCGCGGCGGCGGCGG - Intronic
1104807644 12:131599695-131599717 CCTCTCCGCCTCAGAGCCCCTGG + Intergenic
1104927265 12:132320305-132320327 CGATTCCGCCTCGAGGACGCGGG + Intronic
1104987881 12:132607220-132607242 CGTCTCCGCCTGGGCCCGGCTGG - Intronic
1105475085 13:20721848-20721870 CTTCTCCGGCTCGGGGACGCAGG - Exonic
1112328279 13:98458550-98458572 AGTGGCCGCCTCGGGGCCGGCGG - Intronic
1115752377 14:36505654-36505676 CTTGCCCGCCTCGGGGCCCCTGG + Intronic
1121473574 14:94174670-94174692 CCTCCCCTCCTCCGGGCCGCCGG + Intronic
1122693289 14:103541492-103541514 GGCCTCTGTCTCGGGGCCGCCGG + Intergenic
1124340361 15:28886222-28886244 CGTCCCCGCCCCGCTGCCGCCGG - Exonic
1129780095 15:78264439-78264461 CGAACCCGCCGCGGGGCCGCCGG + Intronic
1129823732 15:78620927-78620949 CCTCTCCGCTTCGCCGCCGCTGG + Exonic
1134143606 16:11742762-11742784 CGCCGCCGCCTCGGGCCCGAAGG + Exonic
1135135773 16:19884732-19884754 CGTCGGCGCTGCGGGGCCGCGGG - Exonic
1136285154 16:29236408-29236430 CGTCTCTCCCTGGGGGCTGCAGG - Intergenic
1140096969 16:71883835-71883857 CCTCGCCCCCTCGCGGCCGCCGG - Intronic
1141079206 16:81035960-81035982 CGCCGCCGCCTCGGGCCCGTGGG + Exonic
1141531402 16:84648915-84648937 CGACTCCGCCTCCTCGCCGCCGG + Intronic
1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG + Intergenic
1141992931 16:87620710-87620732 AGTCTCCTCCTCCGGGCAGCAGG - Intronic
1142090217 16:88206032-88206054 CGTCTCTCCCTGGGGGCTGCAGG - Intergenic
1142434462 16:90047742-90047764 CGACTCCGCTTCTGGGCCCCAGG - Intergenic
1142474273 17:180411-180433 CCTCTCTGCCCGGGGGCCGCGGG + Intronic
1142799632 17:2337280-2337302 GCTCTCAGCCGCGGGGCCGCGGG + Exonic
1143009453 17:3857864-3857886 CCTCTCTGCCTCGGGGCTGCCGG - Intergenic
1143148262 17:4790178-4790200 CGCCTCCGCCTCGGTGGCTCCGG - Exonic
1145094075 17:20009569-20009591 CGTCTTCGCCGCGGGGGCCCCGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1151801889 17:76383906-76383928 CCTCTCCGGCTCGGAGCCCCCGG + Intronic
1152222137 17:79074799-79074821 AGTCCCCGCCGCGCGGCCGCTGG + Intergenic
1152225562 17:79091096-79091118 TGTCTCCTCCTCAGGGCCCCAGG - Intronic
1158277097 18:55780402-55780424 CAGCCCCGCCTCGCGGCCGCGGG + Intergenic
1158954237 18:62523886-62523908 CCTCTCGGACCCGGGGCCGCTGG + Exonic
1160198543 18:76777352-76777374 CCTCACTGCCTGGGGGCCGCTGG - Intergenic
1160810000 19:1009169-1009191 CTGCTCCACCTCGGGGCCGCTGG - Exonic
1161755906 19:6134172-6134194 GGTCTCCACCTCGTGGCCTCAGG - Intronic
1163146200 19:15380392-15380414 CTTCTCCTCCTCGGGGCTGTCGG + Exonic
1163592890 19:18204251-18204273 CCTGTCCGCCTCGGGGAGGCGGG + Intergenic
1163597114 19:18226517-18226539 CGGCCCCGCCTCGAGGCCGGCGG + Intronic
1163622619 19:18369842-18369864 CTTCTCCGCCTGGGGGGCCCGGG - Exonic
1164813631 19:31177426-31177448 CTTCCCAGCCTCGGGGCTGCTGG + Intergenic
1165886783 19:39084386-39084408 CGGCTCACCCTCGGGGGCGCCGG - Exonic
1168282064 19:55311290-55311312 GGTCTCCGCCACGGGACCTCAGG + Intronic
1202693051 1_KI270712v1_random:104893-104915 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693062 1_KI270712v1_random:104937-104959 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693073 1_KI270712v1_random:104981-105003 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693086 1_KI270712v1_random:105025-105047 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693105 1_KI270712v1_random:105094-105116 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693117 1_KI270712v1_random:105138-105160 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693129 1_KI270712v1_random:105182-105204 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693141 1_KI270712v1_random:105226-105248 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693153 1_KI270712v1_random:105270-105292 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693165 1_KI270712v1_random:105314-105336 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693177 1_KI270712v1_random:105358-105380 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693189 1_KI270712v1_random:105402-105424 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693201 1_KI270712v1_random:105446-105468 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693212 1_KI270712v1_random:105490-105512 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693224 1_KI270712v1_random:105534-105556 CCTCTCCGCCGCGCCGCCGCCGG - Intergenic
1202693249 1_KI270712v1_random:105640-105662 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693260 1_KI270712v1_random:105684-105706 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693271 1_KI270712v1_random:105728-105750 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
1202693282 1_KI270712v1_random:105772-105794 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
926268271 2:11344960-11344982 GGGTTCCGCCTCGGGGCCGCGGG - Intronic
928927739 2:36596568-36596590 CATCTCAGCCTCCGGGCAGCTGG + Intronic
930872716 2:56184490-56184512 CGGCACCGCCCAGGGGCCGCTGG - Exonic
933953354 2:87349113-87349135 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
934275639 2:91571368-91571390 CCTCTCCGCCGCGCCGCCGCTGG - Intergenic
934459992 2:94208682-94208704 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
934460010 2:94208752-94208774 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
934460017 2:94208778-94208800 CCTCTCCGCCGCGCCGCCGCTGG + Intergenic
934846371 2:97663709-97663731 CGTCGCCCCCGCCGGGCCGCTGG - Intronic
937261162 2:120587435-120587457 GGGCGCCCCCTCGGGGCCGCGGG - Intergenic
948438066 2:237967226-237967248 CGGGGCCGCCTCGGGCCCGCCGG + Intronic
948993181 2:241564793-241564815 GGTGTCTGTCTCGGGGCCGCTGG + Intronic
1169220593 20:3820253-3820275 CGGCGCCCCCTCGCGGCCGCCGG + Intergenic
1171374395 20:24682357-24682379 CGTCTCCTCCTCGGAGCAGGAGG - Intergenic
1171484814 20:25479000-25479022 CTGCTCAGGCTCGGGGCCGCGGG + Exonic
1174362936 20:50039951-50039973 CTTCTCCTCCTCGGGGCTTCAGG - Intergenic
1175304204 20:57964913-57964935 TGTCTCCGCCATGGGGCCGAAGG - Intergenic
1176414597 21:6467486-6467508 CGTCTCCGCCTCGCCGCAGTCGG - Intergenic
1178413831 21:32387786-32387808 CTTCTCTGCCTTGGGGCCACAGG + Intronic
1178922540 21:36747965-36747987 GGTCGCCGCCTCGGGGCCGCCGG - Exonic
1179490992 21:41741506-41741528 CGTCCACGCCTCGGCGCAGCAGG + Exonic
1179690095 21:43075808-43075830 CGTCTCCGCCTCGCCGCAGTCGG - Exonic
1179882802 21:44300445-44300467 TGTGTCCGACTCTGGGCCGCGGG + Intronic
1181801464 22:25350590-25350612 CGCCTCCTCCTGGTGGCCGCTGG + Intergenic
1181941904 22:26484033-26484055 GAACTCCGCCTCGGGGCCCCGGG - Exonic
1183588380 22:38766315-38766337 TGTCTCCCCCTAGGGGCAGCTGG + Intronic
1185351778 22:50343356-50343378 CGAGACCGACTCGGGGCCGCGGG - Exonic
1185388426 22:50546991-50547013 CCGCTCCGCCTGGGCGCCGCGGG + Intergenic
956674922 3:71724968-71724990 CGTCCTCGCCTCCGGGCCGGGGG - Intronic
968652876 4:1767079-1767101 GGTCTCCCAGTCGGGGCCGCAGG - Intergenic
974716016 4:65669688-65669710 CGCCGCCGCTTGGGGGCCGCCGG + Exonic
985451409 4:190065659-190065681 CGCCTCCGCCTCCGCGCGGCAGG + Intergenic
985452398 4:190068951-190068973 CGCCTCCGCCTCCGCGCGGCAGG + Intergenic
985453383 4:190072248-190072270 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985454373 4:190075541-190075563 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985455361 4:190078834-190078856 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985457333 4:190085428-190085450 CGCCTCCGCCTCCGCGCGGCAGG + Intergenic
985458320 4:190088721-190088743 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985459309 4:190092021-190092043 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
985463561 4:190174790-190174812 CGCCTCCGCCTCCGCGCGGCAGG + Exonic
992233418 5:74685108-74685130 CGACTCCGCCTCCAGGCCCCGGG - Intronic
993839963 5:92865874-92865896 AGACTCCGTCTCGGGGCGGCGGG + Intergenic
995106366 5:108381452-108381474 CGGCTCCTCCTCTGGGCCGGCGG + Exonic
997304158 5:132826000-132826022 CGTGCGCGGCTCGGGGCCGCCGG + Exonic
999300046 5:150485658-150485680 GGTCACCGCCTCGGGGACGCCGG + Intergenic
1006814277 6:36839905-36839927 CGTCTCAGCCCCGTCGCCGCCGG - Exonic
1007759913 6:44127641-44127663 CGGCTCCGGCTCGGAGCCCCGGG - Intronic
1011470277 6:87701608-87701630 CGCCTGCGCTTCGGGGACGCCGG + Exonic
1017719710 6:157236088-157236110 CGGCTCCGCCTGGGGGCTACCGG + Intergenic
1020131792 7:5562939-5562961 CATCCCCGCCTCGTCGCCGCTGG - Intronic
1028373429 7:90119627-90119649 CGCCTCCGCCCCGGAGCCGGAGG + Intergenic
1029139649 7:98400889-98400911 CGGCTGGGCCTCGTGGCCGCCGG + Exonic
1033477213 7:141702262-141702284 CGCCTCCGCGGCGGGGCCCCGGG - Intergenic
1035153301 7:156892852-156892874 CGTCCCCGCCCCCGGGCCCCCGG - Intronic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1042137352 8:65644951-65644973 AGTCTCTGCCTCCCGGCCGCGGG - Intronic
1049396471 8:142403270-142403292 CGGCTCCGCGCCGGGGCCTCTGG - Intergenic
1052991868 9:34523217-34523239 TGGCTCCGCCCCCGGGCCGCAGG - Intergenic
1054255025 9:62802503-62802525 CATCGCCACCCCGGGGCCGCGGG + Intergenic
1057463774 9:95292427-95292449 CGCCGCCGCCTCGGGCCCGTGGG + Intronic
1060407556 9:123380409-123380431 GGTCTCTGCCTCGGGGAAGCAGG - Exonic
1061283642 9:129610582-129610604 CGCCTCCGCCTCCGCGCTGCTGG - Intronic
1062507590 9:136886117-136886139 GGTCTCCGCCCCGGGGCCACGGG + Intronic
1062653531 9:137590429-137590451 CGCCGCCGCCTCGCGCCCGCCGG + Exonic
1187172919 X:16869750-16869772 CGCCTCCGCCCCGGGGCCGAGGG + Exonic
1187464404 X:19515013-19515035 CGCCCCAGCCTCCGGGCCGCCGG + Exonic
1187770154 X:22686508-22686530 CCCCTCCGCCTCGGGGTCCCTGG - Intergenic
1187950419 X:24465324-24465346 GATCTCGGCCTCGGCGCCGCCGG - Intronic
1200141941 X:153906836-153906858 TGTCCCAGCCTCGGGGCCACAGG - Exonic
1200239484 X:154486368-154486390 CTTCGCCGTCTGGGGGCCGCGGG - Intronic